ur epigenome (i.e.

Q: Define histone variant, and explain why histone variants are functionally important.

A: A complex of macromolecules consisting of DNA (deoxyribonucleic acid), RNA (ribonucleic acid), and…

Q: The genetic code table has a list of ___ that code for each of the ___ _______

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: Describe the process of miRNA maturation.

A: Ribonucleic acid (RNA) is a significant biomolecule that is found in every cell of the body. It is…

Q: What does histone acetylation favor?

A: The DNA (deoxyribonucleic acid) in cell is wrapped around proteins called histones. A DNA segment…

Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…

Q: Describe the process of protein synthesis and associated post translational modifications.

A: Post-translational modification (PTM) refers to the covalent and generally enzymatic modification of…

Q: Transcriptionally active chromatin are generally found near the outer regions of the nucleus near…

A: The distribution of transcriptionally active chromatin throughout the nucleus is a complicated and…

Q: why Most somatic cells do not express telomerase

A: Telomerase is a ribonucleoprotein which adds specific dependent telomere repeat sequence to the…

Q: Define epigenetic code.

A: Epigenetics is the study of heritable phenotype variations that do not include changes in the DNA…

Q: Define degenerate code.

A: A codon is a three-nucleotide DNA or RNA sequence that codes for a particular amino acid. The…

Q: how Transposable Elements Are Classified

A: All cellular systems are controlled by proteins. Proteins are synthesized by the cell by a process…

Q: Why are some stem cells called pluripotent?

A: The cell is the basic structural and functional unit of life of all living organisms capable of…

Q: Why is the peptide formation always presented/read from N-terminal to C-terminal?

A: Introduction:  Amino acids are joined together by a condensation reaction between carboxylic and…

Q: Name TWO functions of the 5'UTR.

A: Solution The 5' UTR plays important role in stability, processing and localisation of mRNA.  5' UTR…

Q: how Transposable Elements Can DisruptGenes

A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…

Q: - COMPLETION: Complete the table below, supply the oiven DNA template to its co correct codon and…

A: Introduction:

Q: how Transposable Elements   Alter Genomes

A: A DNA sequence that is capable of altering its position in a genome is termed as transposable…

Q: Define transcription unit.

A: Transcription unit is a stretch of DNA that encodes a single RNA molecule and other sequences…

Q: What are non-histone chromosomal proteins?

A: In the nucleus of each cell in higher organisms, the DNA molecule is packaged into thread-like…

Q: how Splicing is catalyzed by the spliceosome

A: Post-transcriptional modifications are changes that occur to a newly transcribed primary RNA…

Q: What is the epigenome?

A: Genome is the complete genetic information of an organism whereas epigenome is the total epigenetic…

Q: Describe epigenetic alterations .

A: Epigenetic is defined as the study of heritable chemical Modification of DNA or chromatin that does…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Explain the regulation of Transcription-Factor Activity.

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is considered…

Q: Describe the processes of transcription, translation, and post-transcriptional processing.

A: Deoxyribonucleic acid is a polymer made up of two polynucleotide chains that coil around each other…

Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: Define transcription-coupled repair.

A: Transcription coupled repair is a subpathway. Here we will know about the definition of…

Q: Mention the function of non-histone protein.

A: The chromosomes are thread-like structure located in the nuclei of both plant and animal cells. They…

Q: ulate the cell cycle called tumar supressors

A: Tumor suppressor genes can be defined as the normal genes that affect the process of cell division…

Q: The relationship between the nucleotide sequence of an mRNA and the DNA strand from which it is…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: what is the definition of epigenome

A: Epigenetics is the study of how modifications to DNA and histones influence gene expression.…

Q: The three stages of transcription (initiation, elongation, and termination) – with a focus on how…

A: Transcription is a process of production of of RNA from the DNA. It is also called the expression of…

Q: Describe transcription, including the processes of initiation, elongation, and termination.

A: Transcription is one of the processes in central dogma in which information of DNA transcribed into…

Q: Difference between VNTR and hnRNA?

A: Deoxyribonucleic acid (DNA) is the genetic material encoded with thousands of genes. These genes are…

Q: function of a Src homology-3 (SH3) domain?

A: Amino acids can be defined as the building blocks that form polypeptides and ultimately proteins.…

Q: Which of the following is wrong for the description of protein synthesis (A) The large ribosomal…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.