ur epigenome (i.e.

Q: Name the component that is not affected /changes in epigenetic

A: The term 'epi' in the term epigenetics means "in addition to". So, epigenetics involves the study of…

Q: Anatomy of a typical gene

A: DNA or deoxyribonucleotide is the genetic material that is present in many living organisms. DNA is…

Q: Describe the process of miRNA maturation.

A: Ribonucleic acid (RNA) is a significant biomolecule that is found in every cell of the body. It is…

Q: True or false Oncogenes are gene that are normally not found in a cell and must be introduced into…

A: Cancer is a group of diseases involving abnormal cell growth with the potential to invade or spread…

Q: Define GTP ?

A: GTP is Guanosine-5'-triphosphate . During the process of transcription,  GTP which is a  purine…

Q: Promoters of the INS gene

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…

Q: Describe the process of protein synthesis and associated post translational modifications.

A: Post-translational modification (PTM) refers to the covalent and generally enzymatic modification of…

Q: Signal molecules from embryonic cells cause transcriptional changes in nearby target cells in the…

A: Cell signaling(cell communication) is defined as the process the cells use chemical signals to…

Q: How would pyrimidine dimers from the sun effect replication of this gene sequence?…

A: Pyrimidine dimers are the dimers formed between two pyrimidine molecules. Usually it forms between…

Q: ______ mutations in the coding sequences of a gene maymodify the amino acid sequence of the…

A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…

Q: A. Identify a substance or chemical in a certain product that could trigger a genetic disorder. B.…

A: The hereditary ingredient is usually defined as the term that stated that the cell is the genetic…

Q: http://www.letsgethealthy.org/students/games/epigenetics-game/ (Links to an external site.)   For…

A: Genetics is the branch of biology that studies how traits, characteristics, and hereditary…

Q: false: in humans, genes make up more than 50% of the genome.

A: Most genomes, including the human genome and those of all other cellular life forms, are made of DNA

Q: Why is the peptide formation always presented/read from N-terminal to C-terminal?

A: Introduction:  Amino acids are joined together by a condensation reaction between carboxylic and…

Q: Name TWO functions of the 5'UTR.

A: Solution The 5' UTR plays important role in stability, processing and localisation of mRNA.  5' UTR…

Q: RNA _________ Causes Gene Inactivation by Destroying the Corresponding mRNA.

A: RNA interference RNA interference(RNAi) is a mechanism that inhibits gene expression at the stage…

Q: Which of the following statements reflect the difference between RNA and DNA? Multiple answers:…

A: Introduction  The process through which a gene's information is used to create a functioning gene…

Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: : RNA polymerase is capable of binding directly to the promotor site if any gene

A: The RNA polymerase and the necessary transcription factors bind to the promoter region and initiate…

Q: True or False: When determining the transcription start site, there is a nucleotide position…

A: Question - True or False : When determining the transcription start site , there is a nucleotide…

Q: The three stages of transcription (initiation, elongation, and termination) – with a focus on how…

A: Transcription is a process of production of of RNA from the DNA. It is also called the expression of…

Q: Explain the epigenetic mechanisms that underpin gene expression  provide detail examples

A: Asked : Epigenetic mechanisms that underpin gene expression  Epigenetic mechanisms are regulators of…

Q: Albinism (achromia) is a genetic condition in which an individual cannot synthesize melanin from…

A: Albinism is a genetic disorder in which affected peoples show no or little color to the skin, eyes,…

Q: ess(es) are they involved in (for example, r VOU drow it (otiolk figuro)? figurel

A: The gene is one of the units of the genetic material. The genetic material is studied at various…

Q: a. Explain each of the three primary processes involved in mRNA processing in detail.

A: RNA splicing It is a form of RNA processing in which a newly made precursor mRNA is transformed into…

Q: How molecular markers helped locate the gene for cystic fibrosis (CF).

A: Cystic fibrosis (CF) is a genetic disorder. This disease majorly affects the respiratory system…

Q: The genome’s functional gene products are either _____________ or _____________.

A: Genome is the total amount of genetic material that was present in the living organism which…

Q: epigenetic inheritance.

A: The genes are formed by the Deoxyribonucleic acid (DNA) of an organism. These genes code all of the…

Q: A.  Which two of the three modes of RNA processing are necessary to increase mRNA stability?   B.…

A: A.) Three major events constitute pre-mRNA processing: (a) 5'-end-capping, (b) splicing, and (c)…

Q: Transduction: Describe the process of generalized transduction as a type of horizontal transfer. In…

A: Horizontal gene transfer is the process of swapping genetic material between contemporary or…

Q: State whether the gene is up- or down-regulated and briefly explain the reason behind. DNA lacks…

A: Genes are composed of nucleotide bases present in the genetic DNA. A genome is a double-stranded DNA…

Q: how Transposons can move genes to newchromosomal locations.

A: Transposons are the DNA sequences capable of changing its position or location within the genome of…

Q: Finding the Disease-Causing Mutation in Nic Volker’s Genome

A: Answer: Introduction: Young child Nicolas Volker failed to gain weight. Doctors at Wisconsin…

Q: True or False: In eukaryotes, transcription is generally regulated by a combination of many factors…

A: Transcription is the process by which RNA is produced from the DNA (gene). It is also known as the…

Q: draw well labelled Transposon structure

A: Transposons are also known as transposable elements or jumping genes. They are DNA segments that can…

Q: What is exactly done during the process of RNA processing

A: The RNA molecules undergo certain changes after their synthesis known as RNA processing. Both…

Q: Describe what happens when a nonsense mutation is introduced into the gene encoding transposase…

A: Introduction A non-sense mutation is a mutation that terminates translation earlier resulting in…

Q: "once cells have differentiated to their final specialized forms, they never again alter expression…

A: As an individual develops, cell differentiation progresses from the zygote's basic structure to a…

Q: The (blank) gene is constitutively active (always making protein).

A: The segment of DNA that can produce a polypeptide is called gene. It is an inherited factor that…

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.