Q: 33. Which type(s) of proteins do(es) NOT interact with mediator
A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…
Q: Cystic hibros Ife-threatering disease that causes thick, stcky mucus to buid up in areas of the…
A: DNA is the genetic material in living organisms that is transcribed into mRNA. This mRNA is used for…
Q: 3. Describe the mechanism of action of a "statin" drug. What are some of the complications that…
A: Statins are often recommended for lower the cholesterol level in a patient. Statins shows its…
Q: The genomes of chimpanzees and humans are over _________ percent alike. Of the genes that are…
A: Genomics is the study of the entire genome of an organism and the pattern in which the expression of…
Q: What are the three domains of a growth factor receptor and what is the major purpose of each domain
A: Growth factor receptors may be composed of two subunits (heterodimers) and one subunit containing a…
Q: 7 10 P Required HOW ARE PROTEINS MADE? STEP 1: mRNA strands are select.... the select.....…
A: Translation is a process by which cell makes proteins using genetic information carried in mRNA. It…
Q: 9. Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control…
A: Regulatory mechanisms of eukaryotic gene expression.
Q: - Fraumeni Syndrome (LFS) is a rare hereditary cancer disease due to a mutation in the TP53 gene.…
A: P53 is a transcription factor and is a tumor suppressor protein synthesized by tp53 gene. P53…
Q: development involves regulated growth that results from the interaction of the genome with cytoplasm…
A: ANSWER;- false Explain;-No development involves regulated growth that results from the interaction…
Q: of G6PD. Three mutations for G6PD, AAAAGAGGG AAACAUGGG, „CACAAUCAC-CACCAUCAC, AUGACUAAA AUGGCUAAA…
A: There are three main components in our body that help us to store and express the information within…
Q: Describe the distinct SH domains and their binding specificities. How are SH domains in regulating…
A: * specific protein-protein interactions can be mediated by the binding peptides to small modular…
Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…
A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…
Q: Understand the parts of a cell, how cells communicate, and the process of DNA mRNA protein and the…
A: Cells communicate with one another by secreting chemical messages such as neurotransmitters,…
Q: 4. Which or which (can select more than one alternative) of the control methods of genetic…
A: Since we only answer one question at a time, we’ll answer the first one. Please resubmit the…
Q: 34. Explain the mechanism of action of tamoxifen in the treatment of breast cancer.
A: We know that Breast cancer develops as any of the cells in the breast tend to expand abnormally.…
Q: 5. What messages does a gene provide? And how is the language of the gene expressed?
A: A gene can be defined the basic physical and functional unit of heredity. They are made up of DNA.…
Q: Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel…
A: A gene can be described as the complete set of genetic data present in an organism. This data is…
Q: Based on the effects of proper diet and nutrition on reducing susceptibility to COVID19, distinguish…
A: COVID-19 is an emerging infectious disease caused by severe acute respiratory syndrome coronavirus 2…
Q: A mutation within the promoter region can alter transcription of a gene. Describe how this can…
A: 30. A mutation within the promoter region can alter transcription of a gene. Describe how this can…
Q: The main function of t-RNA isa) Proof readingb) Inhibits protein synthesisc) Identifies amino acids…
A: Transfer RNA, also known as soluble RNA is an adapter molecule that is composed of 76 to 90…
Q: 5. How will F-2,6-BP levels and flux through gluconeogenesis be affected in the liver of patients…
A: According to the question, patients with a form of early-onset diabetes were found to carry a…
Q: . Explain the process of transcription in cells?
A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…
Q: 12 of 16 A stress response element is When bound, it tends to transcription. made of DNA; stimulate…
A: The stress response element (STRE), which is found in the regulatory regions of a number of genes in…
Q: Outline the steps of post-translational sorting of proteins tomitochondria.
A: Mitochondria are one of the most important organelles of a cell. These cells are essential to the…
Q: In what mechanisms can genetic information be altered? What are the consequences of these changes?
A: Alteration or changes in genetic information is called mutation. Mutation can be spontaneous or it…
Q: Q9. Using the section of the genetic code below, identify the sequence of mRNA that would code for…
A: More than 150 amino acids are found in nature but only 20 are synthesized during a protein…
Q: Distinguish between:- a. Glycoproteins and Proteoglycans. b. SIRNA and MIRNA
A: Glycoconjugates are carbohydrates that have been covalently bonded to an amino acid,…
Q: 7) The protein VEGF plays an important role in stimulating the formation of new blood vessels. In…
A: VEGF ( vascular endothelial growth factor ) is responsible for the growth of new vessels. In…
Q: How gene expression is controlled? (min 500 words)
A: The genes are the components of the genome that direct specific functions in the cell. Their…
Q: transalational control is dependent on the stability of mRNA molecules
A: Translational mechanisms can also be used to modulate gene expression. These techniques are…
Q: OHO does phenylketonuria affect brain developm How does cancer spread from one tissue to anoi How…
A: Population genetic science is that the study of genetic variation among populations, and involves…
Q: arc associated With it's enpsio 2. what is an operon ? What re Tsiond,bet are Sionu not a partek the…
A: DNA (deoxyribonucleic acid) contains genetic information which is transcribed into amino acids or…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: 9. Explain how a small amount of growth factor can mediate an amplified signal inside the cytoplasm…
A: Signal transduction pathways translate signals received at the cell's surface into cellular…
Q: 1. What is RNA? And, how is RNA modified? 2. What are the 3 major steps involved in mRNA…
A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.
Q: Once created, new combinations of genes will be acted upon by ________________________________
A: New combination of genes are formed either by mutation or by the recombination. New combination of…
Q: differential gene action or selective expression of genes confers to the phenotype of the cell true…
A: ANSWER;- false
Q: Describe the three phases of transcription. Be specific for full credit.
A: Transcription is completed in to three states... 1. Initiation of RNA chain formation 2. Elongation…
Q: 10. Protein expression can be blocked by antisense oligonucleotides. Which mechanism enables…
A: Antisense oligonucleotides bind to messenger RNA (mRNA) and prevents mRNA binding to ribosomes to…
Q: 2. What proteins (2) produced in response to growth factor signaling? are
A: Growth factor signalling is a signalling pathway which functions in growth and proliferation of…
Q: 8 Describe the mechanism that makes paclitaxel an effective drug for breast cancer. Ans=
A: Paclitaxel (PTX), the most commonly used anticancer drug, is used to treat a variety of malignant…
Q: Q2) A. As long as the optimum dosage of the ionizing radiation is achieved it can be used for…
A: Cancer is characterized by the uncontrolled or uninterrupted growth and division of body cells…
Q: 5. In what mechanisms can genetic information be altered? What are the consequences of these…
A: Mutations are sudden heritable change in the DNA sequence that alters the amino acids and then the…
Q: Describe missense and nonsense mutations and how they are different from frameshift mutations.
A: Mutations can be defined as changes in the DNA sequence. It can result from errors in replication or…
Q: 4.) Fully explain the role Gal3 has in the expression of galactose inducible (gal) genes.
A: GAL3 is a gene (protein product is Gal3) present in the yeast and member of galactose inducible gene…
Q: the potential uses of stem cells in research and/or medicine
A: Undifferentiated or "blank" cells are what stem cells are. This means they have the ability to…
Q: Hi, can you please explain the clinical significance of G protein mutations.
A: Introduction:- G proteins control transcription, motility, contractility, and secretion, which in…
Q: HELP PLEASE !! You are looking at a region of the genome that codes for a gene involved in enamel…
A: ORF finder searches for open reading frames (ORFs) in the DNA sequence you enter. The program…
Q: WHAT IF? Suppose X-rays caused a sequence changein the TATA box of a particular gene’s promoter.…
A: The non-coding DNA sequence that is found in the core promoter region of genes in archaea and…
Q: 17. The following is a true statement regarding hydroquinone as depigmenting agents.... A. has a…
A: Skin lightening agents are chemicals that lighten skin color. Hydroquinone, kojic acid, mono benzyl…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Need help ASAP.
1. Give examples of how RNA secondary structure and catalytic RNAs are important in gene expression.
Step by step
Solved in 2 steps
- III. Discuss the following aspects of translation: 1. How does the location and timing of transcription/translation differ between prokaryotes and eukaryotes? 2. How do the types of ribosomes differ between prokaryotes and eukaryotes? 3. How does the first amino acid of the translated protein differ between bacteria, archaea, and eukaryotes?Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third base
- Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.A. =. A Styles Sensitivity Font Paragraph Dictate 7. What are three differences between RNA and DNA? 7. Where is DNA found in the cell? Where is RNA found in the cell? 8. Name the three types of RNA. What is the function of each? Do they function in transcription, translation, or both? 10. What are the steps of transcription? 11. What are the steps of translation? 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following mutations, where mutations and insertions are bolded and deletions are indicated with DNA TAC CGC T C C GCC G T C GA C A AT АСС Аст Mutations: DNA TAC CG C TC C GC C GT C GAC ACT AC C A CT DNA TAC CGG T C C GC GT C GAC A aT ACC AC T DNA TAC CG- T C C GC GTC GACAAT ACCAC T DNA TAC CG CA T CC GCC G T C GACA AT AC ACT What are the consequences of each of these mutations for protein structure? Page 2 of 2 458 words Focus 100%A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)
- 0. Explain how differences in the initiation of translationdictate that eukaryotic mRNAs are monocistronicwhile prokaryotic mRNAs may be polycistronic.Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.MATCH THE FF. WITH THE CHOICES BELOW group of genes one long mRNA with complementary codes of 3 or more genes controlled by negative regulation a tetrameric protein, is the lacI gene product It is a palindromic DNA segment at the upstream region of lac gene has a DNA-binding domain on N-terminus; the C-terminus binds inducer, forms tetramer. an accessory protein to activate transcription regulated both positively and negatively by AraC regulatory elements of arabinose operon It is Regulated Through a Co-Repressor-Mediated Negative Control Circuit an example of autogenous regulation has attenuation regulation mechanism CHOICES: -lac operator -Catabolite activator protein -araBAD Operon -polycistronic mRNA -trp Operon -lac operon -lac repressor -Operon -AraC gene
- BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA1.Describe the journey of a protein, from its synthesis to its final destination 2. Explain the different stages of transcription and the role of the elements involved with the right terminology (template vs. non-transcribed strand, promoter, stop sequence, TATA box, general and specific transcription factors, RNA polymerase II, etc.); 3. Explain what the maturation (modifications) of pre-messenger RNA consists of and its roleB. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as is true under certain test tube conditions). 5' GTAGCCTACCCATAGG 3' What is the complementary DNA strand? 2. Suppose mRNA is transcribed from this DNA using the complementary strand as a template. What will be the sequence of the mRNA? 3. What would be the corresponding anticodons? 4. What peptide would be made if translation started exactly at the 5' end of this mRNA?
