15. The deficiency of glucose-6-phosphate dehydrogenase (G6PD) is one of themost common inborn errors of metabolism worldwide. This congenital disordergenerally results from mutations that are spread throughout the entire geneof G6PD. Three mutations for G6PD, AAAAGAGGG AAACAUGGG,„CACAAUCAC-CACCAUCAC, AUGACUAAA AUGGCUAAA areresponsible for severe deerease of the protein activity. What types of mutationsare these? To answer the question please:I) explain what the mutation is;2) describe the types of mutation you know;3) explain the difference between germline and somatic mutatiymem

There are three main components in our body that help us to store and express the information within…

Answered: of G6PD. Three mutations for G6PD,…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 8QP: Bruce Ames and his colleagues have pointed out that although detailed toxicological analysis has...

See similar textbooks

Similar questions

4. Mitochondrial DNA (mtDNA) encodes some proteins of the ETC. Point mutations of mitochondrial genes can impair the electron transport chain and oxidative phosphorylation. One of the syndrome resulting from disorders of mtDNA-encoding protein is MELAS syndrome (mitochondrial myopathy, encephalomyopathy, lactic acidosis and stroke). The carliest manifestations are the neurological and muscular abnormalities due to the greater dependence of brain, heart and skeletal muscle on mitochondrial ATP synthesis. Explain why 252 Chapter 5. Catabolism and cellular bioenergetics the levels of lactate and pyruvate are increased in MELAS syndrome. For the answer: a) discuss the respiratory control in ETC and significance of the ratio NADH/ NAD; b) describe the reactions of oxidative decarboxylation of pyruvate; c) explain why the disorders in the structures of components of ETC leads to the activation of the reaction, which is catalyzed by lactate dehydrogenase.
4. Ensuring adequate maternal intake of a spe- cific nutrient is especially important in reduc- ing the incidence of the congenital anomaly shown in the image. A deficiency of this nu- trient, when present in an adult, is associated with which of the following conditions? Subarachnoid space (A) Confabulation and anterograde amnesia (B) Diarrhea, dermatitis, and dementia (C) Megaloblastic anemia (D) Megaloblastic anemia with neurologic symptoms (E) Microcytic anemia (F) Polyneuritis and cardiac pathology (G) Swollen and bleeding gums, easy bruising, and poor wound healing HELR
The major enzyme that metabolizes caffeine is: о CYP1A2 0 CYP2B6 o CYP3A4 0 CYP2A6 о CYP2C9
8. Hers discase (type IV) is a rather rare type of glycogenosis inherited in an autosomal recessive manner. In early childhood, patients with Hers disease VI usually present with hepatomegaly mainly caused by a defect in glycogen phosphorylase. Explain why a glycogen phosphorylase defect leads to an increase in liver and hypoglycemia? For the answer: a) name the hormones stimulating glycogen breakdown and indicate different mechanisms of signal transduction by these hormones; b) write a diagram of the process that is disturbed in patients, indicate the enzymes involved in this process, and answer the main question of the problem; c) explain the causes of glycogenosis conditions, give their classification.
A 30 - year - old woman was undergoing therapy for b-thalassemia,a recessive trait caused by absence of or reduced synthesis ofthe hemoglobin b chain, a subunit of the oxygen-carrying moleculein red blood cells. In this condition, red blood cells are rapidlydestroyed, freeing a large amount of iron, which is deposited in tissuesand organs. The blood transfusions the patient had received every twoor three weeks since the age of 7 to stave off anemia were furtheraggravating iron buildup. Her major organs were showing damage, andshe was in danger of death from cardiac disease. Her physician suggestedthat she consider undergoing a hematopoietic (bone marrow)stem cell transplant (HSCT). Since these stem cells give rise to redblood cells, such a transplant could potentially restore her health. Whilethis might seem like an easy decision, it is not. Advanced cases havea high risk (almost 30 percent) for transplantation-related death. At thispoint, the woman is faced with a difficult and…
A 30 - year - old woman was undergoing therapy for b-thalassemia,a recessive trait caused by absence of or reduced synthesis ofthe hemoglobin b chain, a subunit of the oxygen-carrying moleculein red blood cells. In this condition, red blood cells are rapidlydestroyed, freeing a large amount of iron, which is deposited in tissuesand organs. The blood transfusions the patient had received every twoor three weeks since the age of 7 to stave off anemia were furtheraggravating iron buildup. Her major organs were showing damage, andshe was in danger of death from cardiac disease. Her physician suggestedthat she consider undergoing a hematopoietic (bone marrow)stem cell transplant (HSCT). Since these stem cells give rise to redblood cells, such a transplant could potentially restore her health. Whilethis might seem like an easy decision, it is not. Advanced cases havea high risk (almost 30 percent) for transplantation-related death. At thispoint, the woman is faced with a difficult and…
Bruce Ames and his colleagues have pointed out that although detailed toxicological analysis has been conducted on synthetic chemicals, almost no information is available about the mutagenic or carcinogenic effects of the toxins produced by plants as a natural defense against fungi, insects, and animal predators. Tens of thousands of such compounds have been discovered, and he estimates that in the United States adults eat about 1.5 g of these compounds each daylevels that are approximately 10,000 times higher than those of the synthetic pesticides present in the diet. For example, cabbage contains 49 natural pesticides and metabolites, and only a few of these have been tested for their carcinogenic and mutagenic effects. a. With the introduction of new foods into the U.S. diet over the last 200 years (mangoes, kiwi fruit, tomatoes, and so forth), has there been enough time for humans to develop resistance to the mutagenic effects of the toxins present in those foods? b. The natural pesticides present in plants constitute more than 99% of the toxins we eat. Should diet planning, especially for vegetarians, take into account the doses of toxins present in the diet?
Leigh syndrome is characterized by psychomotor regression: that is, the progressive loss of mental andmovement abilities. Patients also suffer from lacticacidosis, a condition in which mitochondrial respiration is deficient, so their tissues metabolize glucoseanaerobically, leading to the buildup of lactate. Somepatients with Leigh syndrome have a mutation in themitochondrial gene MT-CO3, which encodes a subunit of the electron transport complex cytochromec oxidase. Other patients diagnosed with Leigh syndrome have a loss-of-function mutation in the nucleargene SURF1, which encodes a factor needed for theassembly of this same enzyme complex.a. How can the same symptoms result from mutationsin a mitochondrial gene and from mutations in anuclear gene?
Which of the following was added to cell lysate to stabilize RNA molecules during the RNA extraction? Buffer RPE Wash buffer guanidine-isothiocyanate ORNAprotect Bacteria Reagent O silica
Phenylketonuria is a heritable condition in humans characterized by inability to metabolize the amino acid phenylalanine because of failure to produce the enzyme phenylalanine hydroxylase. Among other symptoms. PKUs develop such severe mental retardation that they almost never reproduce. Phenylketonuria children are born to parent who are not phenylketonuria. In as much as Phenylketonuria so rarely reproduce, why does such a disadvantagous gene persist in the population?
A defect in which of the following enzymes leads to Tay- Sachs disease? O Phospholipase CO a-galactosidase A O Hexosamidase A O Sphingomyelinase
>MK585652.1 Sardinella tawilis voucher TaSt3 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial GGTGCTTGAGCAGGGATAGTAGGGACTGCCCTAAGTCTCCTAATTCGGGCGGAGCTAAGCCAGCCCG TTTCTTCATAGTGATGCCAATTCTAATTGGGGGTTTTGGGAACTGGCTCGTCCCTCTAATGATCGGGGC TTCTCCTAGCCTCTTCGGGCGTAGAGGC GGGCAGGGACGGGTTGAACAGTATACCCGCCCTTGGO ATCTCGTCAATTCTTGGGGCGAT ACCACAATTATTAATATGAAACCCCCTGCAATT CAGTCCTGGCTGCCGGGATCACTATGCTATTAACAGATCGAAACTTAAATACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCAATTCTATACCAACACCT The highlighted text refers to the Gene origin Gene identity Accession number O Species identity GGACGACCAGATTTACAACGTCATCGTCACGGCACATGCCTTCGTAATGAT TCCCGCGAATAAACAACATGAGCTTCTGGCTCCTTCCCCCTTCCTTCCTTC of the sequence? SGGGCCTCTGTCGACCTTACCATCTTCTCACTCCACCTAGCAGGT TTGAGCTGTTCTCGTAACCGCTGTGCTTCTCCTTCTCTCCCTTC

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning