e (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3' b) How many different mRNA sequences could code for the protein sequence you determined in 4a? Explain how you came up with your answer (don't write out all the possible mRNA sequences - just explain your logic). Can you help with 4a and sub question b

Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: During the elongation phase of transcription, how is RNA polymerase able to "read" the DNA sequence…

A: Transcription is the process by which the genetic information stored in DNA is copied into a…

Q: The gene ABCD is 1500 bases long.  Answer the following questions:   What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all…

A: A mutation is a known as a change to an organism's DNA sequence. A single nucleotide is altered by…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all…

A: According to the question, the sequence 5 has the mutation highlighted in orange. Also given a…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: The figure shows the position of two of these mutations a and b. The nucleotides are altered in…

A: Note: Your question has 4 sub parts and as per our instructions we ara able to answer only three.…

Q: F10 (PC) or ALT+FN+F10 (Mac). Paragraph Arial 14px

A: Central dogma is the process in which DNA is transcribed in to mRNA is called transcription and mRNA…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Original DNA sequence: mRNA transcript: amino acids: Mutated DNA sequence #3: mRNA transcript:…

A: This practice sheet is about transcription and translation. Transcription is a process in which mRNA…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: One of the initial steps in gene expression is transcription. Only one DNA strand, known as the…

Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…

A: Transcription is the process of conversion of DNA to RNA, in this process the template strand is…

Q: Can you explain the answer and how to find it ? Number 1

A: Any Change in the genetic material, which is not caused by recombination, tnat leads to altered…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: E) In the drawing above, indicate the position of features in the mRNA that determines the start of…

A: Introduction Translation involves the syntheisis of proteins by reading the codons on mRNA by tRNA…