bose forward and reverse primers to amplity gene x 5'ATTAGTCATGCCAACTTGCACTGATATGA...geneX...CCAGGCGCTAACCTAGATCGCTAGTATCG3' Forward primer: A. 5'-AGTCACGTTCAACCGTACTG-3' B. 5'-GTCATGCCAACTTGCACTGA-3' C. 5'-TCAGTGCAAGTTGGCATGAC-3' D. 5'-CAGTACGGTTGAACGTGACT-3' E. other? Reverse primer: A. 5'-TGATCGCTAGATCCA CGC-3 B. 5'-CGCTAACCTAGATCGCTAGT-3' C. 5'-ACTAGCGATCTAGGTTAGCG-3' D. 5'-GCGATTGGATCTAGCGATCA-3' E. other? * Sequences above are 20mers with 50%GC.

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: Many types of breast cancer have chromosomal translocation mutations. What scenario best describes,…

A: *Translocation is one type of chromosomal abnormality which  chromosome breaks and it's portion will…

Q: a bacterial cell in which the [ Choose ] F plasmid has become part of the chromosome lesion caused…

A: Given: To match all the given explanation with wording.

Q: Hơ many mismatches would you expect to find between this sequence and the reference sequence? I…

A: Mutation is any alteration or modification or change in the nucleotide sequence, resulting in a…

Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…

A: False  The target will be cleaved.

Q: . a. Mice engineered to block expression of the geneencoding the telomerase protein age at a…

A: Telomerase is an enzyme that is essential for the replication of chromosomal ends. It is a…

Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…

A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of the…

A: GAL1 transcript is the mechanism through which RNA polymerase II in eukaryotic cells transforms the…

Q: a. The original constitutive operator mutations in thelac operon were all base changes in o1. Why…

A: The original constitutive operator mutations made in the lac operon involved base changes in the O1.…

Q: What would be the consequence of inserting 10 random base pairs immediately downstream of the -10…

A: The insertion of 10 random base pairs immediately downstream of the -10 box in a strong promoter may…

Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…

A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…

Q: Which set of fragment ions is likely from the same population of precursors ions (parent peptide)…

A: ANS:- None of the described choices are likely.

Q: a. How many enhancers were you able to identify with these set of experiments? Explain. b. If you…

A: Enhancers are the term used for the regions of DNA (deoxyribonucleic acid) that elevate the…

Q: ''The chemical carcinogen dimethylbenz[a]anthra-cene (DMBA) must be an extraordinarily specific…

A: Abnormal growth of skin cells when exposed to sunlight causes skin cancer. They are originated from…

Q: 20 of 22 If a strand of MRNA has the sequence 5'-CUGUCA...ACUC-3' (with [….] representing the…

A: Transcription process takes place in the nucleus. It is responsible for producing mRNA from template…

Q: Describe the primary procedure(key steps no details) that you will follow to clone the C-peptide…

A: C-peptide or connecting peptide refers to the polypeptide spanning 31 amino acids that connects…

Q: 11. You isolated a gene expressed in differentiated hepatocytes in mice. You then fused various…

A: A gene consists of promoter, enhancer, silencer, functional gene, introns ,termination sequences…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…

Q: AAG a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the…

A: “Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…

A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…

Q: 20 ORF for gene X e for gene X above has a hypomorphic mutation (which you name Mutation #1) that is…

A: Answer.) :-The given question presents an experimental scenario involving Gene X, which has a…

Q: CpG is an epigenetic term which me a. The binding of the sense cy O b. The binding of cytidine to O…

A: CpG site The CpG sites or CG sites are regions of DNA where Cytosine nucleotide is followed by a…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Based on the BLASTp and Reciprocal hit analysis is mus musculus a true ortholog for the human fgfr3…

A: Ortholog genes are those genes which are present in different species but have a common ancestor.…

Q: 6) The C-terminal domain (CTD) of yeast RNA polymerase II (RPB) subunit RPB1 contains the repeating…

A: RNA polymerase: it is the enzyme involved in transcription of genetic material, DNA.

Q: Has mutated terminal sequences and lacks a functional transposase or reverse transcriptase. Has…

A: Transposable elements (TEs) are DNA or RNA sequences that have the ability to relocate within a…

Q: both noncoding and coding). a. Which types of SNPs affect protein production or function for the…

A: Single Nucleotide Polymorphisms are the specific differences in the chain of DNA in different…

Q: a b A-T (FT169) Vector IR (10 Gy): WT Wortmannin: IR (10 Gy) cap T2609 «DNA-PKcs 1 2 3 1 2 3 4 Ku80…

A: Phosphorylation of a molecule is the process of attachment of phosphoryl group.

Q: In addition to Tc1, the C. elegans genome contains otherfamilies of DNA transposons such as Tc2,…

A: Transposons are mobile DNA segments. They can replicate and insert copies at various chromosomal…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: A particular type of anemia in humans, called b-thalassemia,results from a severe reduction or…

A: A disease is a state of unhealthiness of the physical body, mind and social interaction. A disease…

Q: What would you expect krox20 expression to look like in embryos treated with an RA inhibitor? Why?…

A: krox20 is also known as early growth response protein 2, it is a transcription regulatory factor.it…

Q: In Figure 6-19,a. what do the square/triangular pegs and holesrepresent?b. is the suppressor…

A: Mutation is a permanent change in the genetic material (the genome) of a cell of a live creature or…

Q: Your insert has the sequence TGGATCCTTATAATGTTT.....Which pET-41 vector will you use to clone with…

A: To determine which vector is best for you, you will need to consider the reading frame of your…

Q: Knock out mice that are mutant for a gene product X die. Variants of the X gene that were…

A: The physical crossing over during meiosis of parental heterozygous homologous chromosomes or genes…

Q: A O 1 2 3 456 7 8 9 CG site number 1 2 3 4 5 6 7 8 9 CG site number *p<0.05 ##p<0.01 The viable…

A: The study discussed in the question examines the impact of BPA exposure on the methylation of the…

Q: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of…

A:

Q: Now we will move on to module 3, where we will examine autoradiographs produced from Sanger…

A:

Q: In this scenario, we'll be discussing the Xtina gene, which encodes the Xtina protein. Xtina is…

A:

Q: ur epigenome (i.e.

A: a) Epigenetics is the study of heritable changes in the gene expression (active versus inactive…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure, which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material in most of the organisms that carry coded…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.