Bacteriophage lambda (λ) consists primarily of a head, which contains the genomic DNA, and a tail that is involved in phage attachment to bacterial cells. The diagram to the right represents the bacteriophage lambda genomic DNA, showing the locations of important gene clusters (Ausubel et al. 1998). Arrows below mark the sites where the restriction enzyme HindIII cuts the DNA, and the numbers indicate the number of base pairs in each fragment.   The restriction enzyme HindIII cuts the λ genome 7 times, how many fragments are produced following this reaction?

Q: Provide 2 diagrams to illustrate the 2 potential recombinant plasmids,

A: The question here states about the concerned recombination of cloned plasmids and their…

Q: Plasmid is  3.6kb large. It is digested with an enzyme that has restriction sites at  1,152 and…

A: Plasmids are circular DNA found in bacteria. They are extra chromosomal materials and are highly…

Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…

A: The base composition of the genetic material is the same in all the species present on earth. The…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: If you are using a restriction enzyme that make 8 cuts in the Lambda phage DNA, how many bands…

A: Introduction :- Restriction enzymes are bacterial enzymes that cuts the double stranded DNA molecule…

Q: A geneticist isolates two mutations in a bacteriophage. One mutation causes clear plaques (c), and…

A: The geneticist mixes two phages having genotype c+ m+ and genotype c− m− and used the mixture to…

Q: A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two…

A: The episomal vectors are the plasmid constructions that replicate in both eukaryotic and prokaryotic…

Q: Single and double digestion of plasmid pJC716 were performed using the restriction enzymes EcoRI and…

A: Plasmid is a double stranded circular dna molecule that is capable of replicating independently. It…

Q: The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots…

A: The genes are the sequence of nucleotides that are present on the chromosomes and encode for a…

Q: Several common antibiotics affect some strains of bacteria's ability to carry out transcription…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Draw a representative agarose gel showing the bands, and the direction of current flow as well point…

A: EcoR1 is a restriction enzyme that can cleave a dsDNA at the sequence GTTAAC. They cleave the cite…

Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…

A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…

Q: The following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that…

A: "Investigating the results of DNA repair through non-homologous end joining (NHEJ) following Cas9…

Q: A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first…

A: BASIC INFORMATION  RESTRICTION ENZYME  they are also known as molecular scissors it was in the year…

Q: Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical…

A: BLAST is a bioinformatics tool that enables us to identify a gene if we know its DNA sequence or the…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: In this western blot, the levels of phosphorylated TBK (PTBK) decrease with increasing…

A: Western blot analysis is the assay done to check expression of protein. In this method, proteins are…

Q: In a study, bacterial culture of E. coli was infected with bacteriophage. How- ever, these cultures…

A: A restriction endonuclease is a bacterial enzyme that cuts double stranded DNA by cleaving the…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: The bacteriophage genome consists primarily of genes encodingproteins that make up the head, collar…

A: The virus is microscopic and is even smaller than bacteria. They have their genetic material…

Q: Four different types of molecules, namely A, B, C and D were isolated from a primitive life form and…

A: All of these are likely to be the genetic material for the primitive life form.

Q: After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that…

A: Bacterial transformation is a process through which bacteria can take up foreign DNA. Transformation…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: DNA can be cut at specific sequence motifs using enzymes called restriction endonucleases. You…

A: One of the essential tools of molecular biology and recombinant DNA technology is restriction…

Q: F ′strains in E. coli are derived from Hfr strains. In some cases, these F ′strains show a high rate…

A: Conjugation is transfer of genes in bacteria.cell to cell contact by F-pilus or sex pilus allows the…

Q: By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the…

A: Genetic material is transferred  between bacterial cells by direct cell-to-cell contact or by a…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Some S. aureus strains can produce an enzyme called beta-lactamase, which breaks down beta-lactam…

A: bacteria have dna as their genetic material .

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: The diagram below shows that of a plasmid containing genes that confers erythromycin (Erm®) and…

A: Plasmids are small circular double-stranded DNA molecules that store additional genetic information…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: E. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: A shuttle vector is a vector (usually a plasmid) different host species. One of the most common…

A: Shuttle vector It refers to the type of vector, often a plasmid designed to spread among two…

Q: The bacteriophage genome consists of many genes encoding proteins that make up the head, collar,…

A: Bacteriophages are the group I viruses that have double-stranded DNA as their genome.

Q: Explain how site directed mutagenesis can be accomplished using M13 bacteriophage. Using this method…

A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…

Q: The following DNA sequence has been identified and named ‘Gene Z’. It is thought that this sequence…

A: PCR is a polymerase chain reaction, this is a biotechnological process which is used to amplify the…

Q: A researcher has a Trp− auxotrophic strain of E. coliwith a mutation in a single gene. To identify…

A: An auxotrophic mutant refers to the strain having a mutation that does not allow the strain to…

Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…

A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…

Q: Determine the map distances between the genes.

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…