Answered: A. Ligase B. Hydrolase C. Kinase D.…

Science

Biochemistry

A. Ligase B. Hydrolase C. Kinase D. Oxidoreductase

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter4: How Cells Obtain Energy

Section: Chapter Questions

Problem 12RQ: The cholesterol synthesized by cells uses which component of the glycolytic pathway as a starting...

See similar textbooks

Related questions

Q: 49 and 50

A: Question no. 49: The reaction involves a substitution reaction of a nitro-substituted benzene ring…

Q: On the image showing the transcription of DNA to RNA, what does the letter F represent? Select the…

Q: For each of the following liver enzymes, indicate what happens to the enzyme (i.e.,…

A: Certainly! Let's explore how glucagon influences liver enzymes in detail, focusing on each enzyme's…

Q: What are the different types of radioligand binding assays? What kinds of information do they…

A: Radioligand binding assays are a type of biochemical assay used to study the interaction between a…

Q: None

A: In conclusion:Based on the computation above, C8H14I2 will be the molecular formula. Having 485.9190…

Q: Please help with biochemistry problem

A: The diagram is showing parts of a sarcomere, the basic unit of muscle contraction. The labeled…

Q: 5. For the reaction 2C6H5COOH(s) + 1302(g) 50 °C. PO3 - 12CO2(g) +6H2O(l), calculate A,H° at

A: Given Standard Enthalpies of Formation…

Q: Consider this structure. + N Part: 0/3 Part 1 of 3 HO Identify the monosaccharide. Select the single…

A: Answer: D-2-deoxyribose The structure in the image is of a nucleotide, specifically a…

Q: Can a reduction reaction during phase I metabolism of a drug happen without the addition of a…

A: In biochemistry, a reduction reaction is one in which a molecule gains electrons. This is often…

Q: None

A: How to convert:Write the conversion factors as fractions to such that when multiplied, will cancel…

Q: how are multicompartment models different from single compartment models in pharmacology?…

A: In pharmacokinetics, a single compartment model is a simplified representation of drug distribution…

Q: Draw the structures of the amino acids formed at physiological pH when the tripeptide below is…

Q: Draw the skeletal structure for the product(s) that form(s) when the alcohol 2-butanol…

A: When 2-butanol (CH(3)CH(2)CHOHCH(3)) is oxidized, it can form different products depending on the…

Q: A seminal paper on the reaction of singlet oxygen with the DNA base guanine was published by C.S.…

A: The mechanism for the formation of 8-oxo-7,8-dihydroguanine (8-oxo-G) from guanine and singlet…

Q: Please help me solve 1 for the phi and psi dihedral angles.

A: The Ramachandran plot is a crucial tool in protein chemistry for visualizing the conformational…

Q: Explain question 4 thoroughly.

A: In salicylic acid, there are two functional groups with acidic protons: the carboxylic acid group…

Q: This is a graded question. Do it yourself. Draw the line-angle structure of a tertiary amine that…

A: Step 1: Step 2: Step 3: Step 4:

Q: Calculate the average charge of H3A+ at pH 5.10 (pKa = 2.1, 3.9, 9.8). (Hint: remember that the…

A: Step 1:Step 2:Step 3:

Q: Where does a label on carbon 2 in glucose end up after 1 round of the TCA cycle. How many cycles…

A: Question 1: Label Tracking in the TCA Cycle and CO₂ ReleaseLocation of Label on Carbon 2 of Glucose…

Q: Classify each disease or condition according to the type(s) of vaccination used. Inactivated…

A: Types of Vaccines:Inactivated Vaccines: Contain killed or inactivated pathogens that cannot cause…

Q: Biochemistry problem: Please help with problem in the attached image. The following information is…

Q: For Sample 1, the glucose/fructose standard (0.2 mg/mL for each of glucose and fructose): From the…

A: Step 1:Step 2: Step 3: Step 4:

Q: None

A: Answer information:Step 1:The impact of ligands on the d-orbitals of the core metal ion is taken…

Q: Please solve - no AI answers

A: To solve this, let's analyze the plasmid map and where the restriction enzymes cut:Plasmid size:…

Q: Would it be a good idea to make up a pH 4.0 sodium acetate buffer? Why or why not?

A: 1. Buffer Capacity and Effective pH Range:A buffer is most effective when it is within ±1 pH unit of…

Q: Give the IUPAC name for each structure. Part 1 of 3 CH3(CH2)2CO2CH2CH3 Part 2 of 3 Part 3 of 3…

A: Step 1: Rule for writing IUPAC name for Ester(i) First component of an ester name, the alkyl is…

Q: please help with this

A: Option 1 (AUCAUUCUAUUGUCCUCCACC) brings change in which UGA (encoding Cysteine) becomes UCA…

Q: help me with part b part i and iii please . for iii. the hint is that A is constant so H and S…

A: 【i】The answer from part (a) (which would be your ΔH and ΔS values) are incorporated directly into…

Q: I need help on Part B

A: Detailed explaination:1. Starting Compound (8-oxo-G):8-oxo-G (8-oxo-7,8-dihydroguanine) is a…

Q: Draw a schematic of the chemical structure of the Leu-Tyr-Met-Lys tetrapeptide, with the correct…

A: Structure of Leu-Tyr-Met-Lys at neutral pH (7) : At neutral pH (around 7), the ionization state of…

Q: Which of the species have bond angles of 109.5° and which of 120° ? Drag the appropriate items to…

A: Step 1: Step 2: Step 3: Step 4:

Q: 2) Calculate the pH during the titration of 20.00 mL of 0.1000 M butanoic acid (K,-1.54x10%) with…

A: Step 1:Step 2: Step 3:Step 4:Step 5:

Q: Draw a skeletal structure for the cis isomer of 2-methyl-3-heptene. Click and drag to start drawing…

A: Step 1:Hept means long chain has 7 carbons Ene means double at C3 Methyl substituent at C2 Step 2:…

Q: A har are the hybridizations of atoms I and II? (A) I-sp and II - sp³ (B) 1-sp and II-sp 1-sp² and…

A: Step 1:In compound if carbon form 4 sigma bonds, the hybridization is sp3 If form 3 sigma and 1 pi…

Q: The chemical compound cyanogen burns with a flame that has a temperature of about 8,177 degrees…

Q: Biochemistry question: Which of the following is LEAST likely to be required for a series of…

A: Catabolism involves the breakdown of molecules to release energy. Common pathways include…

Q: Biochemistry Question Seven - Which steps of glycolysis are not reversible for gluconeogenesis? How…

A: Irreversible Steps in Glycolysis and Their Bypasses in Gluconeogenesis: Glycolysis is a metabolic…

Q: Only 100% sure experts solve it correct complete solutions need okkk don't use chat gpt just do it…

A: Step 1: Step 2: Step 3: Step 4:

Q: The pyruvate dehydrogenase complex catalyzes the synthesis of acetyl-CoA, a very important molecule…

A: In the process of cellular metabolism, the pyruvate dehydrogenase complex (PDC) is responsible for…

Q: © Macmillan Learning Classify each amino acid as polar neutral, hydrophobic, positively charged, or…

A: To classify each amino acid based on the categories provided:Polar Neutral:Thr (Threonine): The…

Q: Do letter 4 and draw a titration curve as directed in letter 4 c) for pka 4.7, labelling all the…

A: 4. a) Ionization Reaction of Water and the Equilibrium Constant ExpressionWater (H₂O) can act as…

Q: Which of the following accurately describes the enzymatic regulation of glycolysis? Glycolytic…

A: Glycolysis is one biological pathway included in cellular respiration and this starts with a glucose…

Q: Determination of phosphorus in blood serum gave results of 4.40, 4.44, 4.64, 4.46, and 4.49 ppm P.…

A: Step 1:To determine whether the 4.64 ppm phosphorus result is an outlier using the Q-test at a 95%…

Q: Modify the mannose structures provided to show the structure of a disaccharide formed from two…

A: To modify the mannose structures to show the formation of a disaccharide with a 1 → 6-β-glycosidic…

Q: Convert the condensed formula (CH3), CHCH₂OCH2CH3 to a complete structural formula by adding all of…

Q: An atomic absorption method for the determination of the amount of iron present in used jet engine…

A: To calculate the confidence intervals, we will use the following formula for a confidence interval:…

Q: Consider the structure of the steroid cholesterol for the following questions. Part 1 of 4 Which of…

A: Part 1:Steroid structures have four rings labeled as A, B, C, and D:Ring A is the first (leftmost)…

Q: f. If the IUPAC name for HO-CH2-CH2-OH is 1,2 ethane diol (see handout and the posted link to…

A: Thank you.

Q: Biochemistry Question Five A - Discuss the steps for lipid biosynthesis.

A: Approach to solving the question: lipid metabolism Detailed explanation: explained iin detail Key…

Q: 1. (6 pts) You are given a solution wherein [OH‍] is 3 fold higher than the concentration of [H+].…

Question

Biochemistry question:

The formation of ADP from ATP and the transfer of inorganic phosphate to a substrate is
most likely catalyzed by which class of enzyme?

The answer choices are in the attached image.

Please help . Thank you

A. Ligase
B. Hydrolase
C. Kinase
D. Oxidoreductase

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Using the answer code on the right, indicate which form of energy production is being described: 1. takes place in the mitochondrial matrix 2. produces H2O as a by-product 3. results in a rich yield of ATP 4. takes place in the cytosol 5. processes acetyl-CoA 6. takes place in the mitochondrial innermembrane cristae 7. converts glucose into two pyruvate molecules 8. uses molecular oxygen 9. accomplished by the electron transport system and ATP synthase (a) glycolysis (b) citric acid cycle (c) oxidative phosphorylation
Does physical exercise to increase muscle mass involve anabolic and/or catabolic processes? Give evidence for your answer.
________ are always changed by participating in a reaction. a. Enzymes c. Reactants b. Cofactors d. Coenzymes
Enzymes _______. a. enhance reaction rates b. are affected by pH c. act on specific substrates d. all of the above
Which molecule does not form during glycolysis? a. NADH c. oxygen (O2) b. pyruvate d. ATP
Cells expend energy on what three categories of activities?
The control of which enzyme exerts the most control on glycolysis? hexokinase phosphofructokinase glucose-6-phosphatase aldolase
Chemiosmosis involves a. the movement of electrons across the cell membrane. b. the movement of hydrogen atoms across a mitochondrial membrane. c. the movement of hydrogen ions across a mitochondrial membrane. d. the movement of glucose through the cell membrane.
Beta oxidation is ______. a. the breakdown of sugars b. the assembly of sugars c. the breakdown of fatty acids d. the removal of amino groups from amino acids
PREDICT In the following reaction series, which enzyme(s) is/are most likely to have an allosteric site to which the end product E binds? (a) enzyme 1 (b) enzyme 2 (c) enzyme 3 (d) enzyme 4 (e) enzymes 3 and 4
The capacity to do work best defines: a metabolic pathway. entropy. kinetic or potential energy. a chemical equilibrium. thermodynamics.
How Art the Enzymes of Metabolic Pathways Organized? Name the four principal modes of enzyme organization in metabolic pathways.