Please solve - no AI answers ECORV550bp400bpPstl350bpPlasmid DNA2000bp- EcoRIBamHI700bpDescribe the DNA fragments (number and size) generated when this plasmid is digested with EcoRI and EcoRV.Number of fragments:Size of smaller fragment:bpSize of larger fragment:bp

To solve this, let's analyze the plasmid map and where the restriction enzymes cut:Plasmid size:…

Answered: ECORV 550bp 400bp Pstl 350bp Plasmid…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Similar questions

Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
HindlII ECORI ECORV BamHI 379 Sall Pstl. tet amp Plasmid PBR322 1000 4361 bp ori Ndel If you were going to use this vector to clone a foreign fragment of DNA, what two restriction enzymes would you use to cut the vector, so you could make a recombinant plasmid that has AmpR and KanR (Kanamycin resistance), but No TetR. Assume the insert DNA does NOT have a Tet resistance gene but does have a Kanamycin resistance gene. O EcoR1 and Hindll O Pst1 and Sal1 O Pst1 and Nde1 O EcoR1 and Nde1 f6
Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How many fragments and how big each fragment should be after digesting the plasmid with PvuI? How many fragments and how big each fragment should be after digesting with both enzymes? Show your calculation/explanation.
See image
You wish to insert a gene in the plasmid below. (Note the neon green lines represent restriction sites.) amp gene BamHI Sacl Saçl EcoRI BamHI 33 BamHI Gene of interest Chromosomal DNA from human cells a) Which restriction enzyme should you use to cleave the plasmid? Explain your answer. b) How would you create a cDNA library for the chromosomal DNA containing the gene of interest? c) The green area on the plasmid is the ampicillin resistance gene. Explain how you would use it to screen for a recombinant plasmid. 1
A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI
B 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairs
EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
Please don't provide handwriting solution

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Concepts of Biology

Biology

ISBN:

9781938168116

Author:

Samantha Fowler, Rebecca Roush, James Wise

Publisher:

OpenStax College

SEE MORE TEXTBOOKS

ECORV 550bp 400bp Pstl 350bp Plasmid DNA 2000bp - EcoRI BamHI 700bp Describe the DNA fragments (number and size) generated when this plasmid is digested with EcoRI and EcoRV. Number of fragments: Size of smaller fragment: bp Size of larger fragment: bp