ECORV 550bp 400bp Pstl 350bp Plasmid DNA 2000bp - EcoRI BamHI 700bp Describe the DNA fragments (number and size) generated when this plasmid is digested with EcoRI and EcoRV. Number of fragments: Size of smaller fragment: bp Size of larger fragment: bp
Q: A trait has a heritability of 0.15. This suggests: Question 5 options: The…
A:
Q: During phase I metabolism of a drug, how would the addition of a hydrogen or removal of an oxygen…
A: Phase I metabolism of a drug involves chemical reactions such as oxidation, reduction, and…
Q: Which of the species have bond angles of 109.5° and which of 120° ? Drag the appropriate items to…
A: Step 1: Step 2: Step 3: Step 4:
Q: In spectrophotometry, we measure the concentration of an analyte by its absorbance of light. A low…
A: The absorbance detection limit (ADL) in spectrophotometry is a measure of the lowest absorbance…
Q: An investigator briefly incubates an actively respiring bacterial culture with [1-14 C]glucose and…
A: Respiration includes the processes of Glycolysis ---> link reaction ---> Krebs cycle. We all…
Q: You have discovered an organism incapable of performing the full gluconeogenic pathway. Further…
A: Missing Enzyme in the Gluconeogenic PathwayIdentification of the Missing EnzymeThe organism in…
Q: Note: Reference the Conversion factors for non-SI units and SI prefixes tables for additional…
A: Step 1: We know 1 kJ = 0.239 calory So 4240 kJ = 4240 * 0.239 calories 4240 kJ = 1013.3843…
Q: Consider the titration of a 23.0-mL sample of 0.110 M HC2H3O3 (Ka=1.8\times 10−5) with 0.120 M…
A: volume of base required to reach equivalence point = (0.110 M x 23 ml)/0.120 M = 21.1ml of NaOH pH…
Q: Give the IUPAC name for each ketone. Part 1 of 2 H₂C HC H₂C. C CH2 Part 2 of 2 ☑ CHCH CH₂
A: Step 1: Guidelines for IUPAC nomenclature of organic compounds:Consider the carbon chain with the…
Q: 3. Consider Anfinsen's classical protein folding experiment. SH G=A Native (100% active) Ğ Native 1.…
A: The experiment that Anfinsen conducted to establish the classical folding of proteins proved that…
Q: None
A: To solve this, we need to understand the process of water ionization, which is a fundamental concept…
Q: Match each autoimmune disease with its characteristics and the immune cell/s or molecules most…
A: Refer to the solution
Q: None
A: As the liver is responsible for maintaining blood glucose levels, it actively synthesizes glycogen…
Q: U You record and plot the kinetics of an allosteric enzyme in three experiments. First, you measure…
A: Important Terms: Allosteric EnzymesAllosteric enzymes are proteins that change their conformation…
Q: please help
A: To interpret the sequencing gel: 1. Identify the Bands: - Each lane represents where synthesis is…
Q: If you had added 1.0 mL of 1.0 M HCl to your 50 mM potassium phosphate buffer solution, would it…
A: Step 1:Find moles of bufferHCl solution is 1.0 M and you added 1.0 mL (0.001 L).Moles of HCl = 1.0 M…
Q: 7. Prediga el(los productos) de la siguiente reacciones: SO3H CI AICI 3, CH2Cl2, Anhidro, N2 atm.…
A: Please let me know if there are any queries, so that i can help through.
Q: Which of the following statements is correct for the reaction catalyzed by chymotrypsin? ○ The…
A: For the reaction catalyzed by chymotrypsin, the correct statement is:The substrate carbon atom…
Q: U Below are three hypothetical reaction intermediates: 2 CH3 CH3 C=0- C=0- H-C- H-C-H H-C- Н 3 CH3…
A: Let's analyze three hypothetical reaction intermediates , focusing on stability of carbanions and…
Q: 6. You must dilute two standards. Standard 1 has a albumin value of 8.5 g/dl. Standard 2 has an…
A: Step 1: Step 2: Step 3: Step 4:
Q: None
A: Explanation :Step 1: Understanding the ProblemWe need to determine the solubility of zinc hydroxide,…
Q: Determination of phosphorus in blood serum gave results of 4.40, 4.44, 4.64, 4.46, and 4.49 ppm P.…
A: Step 1:To determine whether the 4.64 ppm phosphorus result is an outlier using the Q-test at a 95%…
Q: Show the sequence please( please steps by step answer please)
A: Step 1:Alkene react with water in acidic medium to form alcohol This reaction follow markonikovs…
Q: Can you summarize the steps of renal excretion of a drug, outlining the sequence and explaining…
A: Renal excretion is the process by which the kidneys filter out waste products and excess substances,…
Q: 11. Match each statement below to the appropriate nucleotide. The options include A, I, C, G, U, and…
A: Identification of Nucleotide BasesImage Analysis and IdentificationThe nucleotide bases depicted in…
Q: None
A: The reaction of 1,3-dimethylbut-1,3-diene** with **methyl isobutyl ether** under heat doesn't…
Q: How does it go further I'm confused
A: 1. The ester functional group may be rearranged in the first reaction, for as through a Claisen…
Q: Ramipril is an ACE inhibitor that contains an ester, amide, and other functional groups. Part: 0/2…
A: The ester group in ramipril is the carbonyl group (C=O) attached to the oxygen atom. Hydrolysis of…
Q: Help 15.2.2
A: Ionic charge on this molecule at pH 1.0 is ( +1) Thorough explanation is given in the image.
Q: Assuming ideal behavior, rank the solutions boiling points, 1 is lowest to 4 highest boiling point:…
A: Step 1:Boling point of solution is a collegiate property, which depends on the number of particles…
Q: Please help and explain this question in depth.
A: Step 1Chromatography: Size exclusion chromatography separates biomolecules based on their size,…
Q: How should a sample intended for total metals analysis be digested?
A: Step 1: Above there is all the explanation given.. Step 2: Step 3: Step 4:
Q: Draw the major product of the following Heck reaction. MeO Pd(OAc)2 (1 equiv) AcOH 63% Draw the…
A: SOLUTION : EXPLANATION : Oxidative addition occurs in the first step. Pd(0) oxidises itself into…
Q: Assume the helium-neon lasers commonly used in student physics laboratories have power outputs of…
A: Please see the attached images for the solution. If there are queries or if the images are not…
Q: Which of the following statements most closely describes the quaternary structure change of…
A: let's break it down: Deoxyhemoglobin (deoxyHb) refers to the form of hemoglobin that does not have…
Q: During glycolysis, the enzyme glyceraldehyde phosphate dehydrogenase (GAPDH) catalyzes the oxidation…
A: Approach to Solving the Question:To determine the conditions that are most likely to directly alter…
Q: Which of the following are the reduced (high energy) forms of the electron carriers nicotinamide…
A: NADH2; FADH2: In biochemistry, NADH and FADH2 are the reduced forms of NAD+ and FAD, respectively.…
Q: None
A: A) Convert 58.76 Ms to ks:58.76 Ms = 58760 ksB) Convert 4.313 in/mi to cm/km:4.313 in/mi = 6.802…
Q: Please explain thoroughly (8 & 9). Step by step. This is an ungraded assignment (which will not…
A: Step 1: Step 2: Step 3: Step 4:
Q: Please step by step answer and don't use ASI Answer please
A: Here's a summary of the reactions:Reaction 10:Starting Material: Aldehyde with a double…
Q: Draw the skeletal structure of the products formed when the given triacylglycerol is hydrolyzed with…
A: Triacylglycerol is a type of lipid. Triacylglycerols are composed of a glycerol molecule and three…
Q: You are examining the effects of a mutation in the proximal histidine of a heme-containing protein.…
A: The heme will bind to O2 more effectively than to CO: This option is incorrectThis option implies…
Q: Identify the cell types, transcription factors, and cytokines associated with Type 1, 2, and 3…
A: Solution:Each type of immune response is characterised by specific cell types, transcription…
Q: Help me understand this…I’m confused
A: Refer to the solution
Q: Of the following statements, which is FALSE? Liquids and gases both take on the shape of their…
A: 1) both and gases have no specific shape. So they can take the shape of the container they are in.…
Q: help 5
A: Chitin is a linear polymer found in the exoskeletons of insects and crustaceans. So, option 1 is…
Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…
A: Genetic code table basis:Reference:…
Q: Explain throughly (a and b)
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: 7. You need to prepare an acetate buffer of pH 5.53 from 0.0875 M Acetic acid solution and 2.02 M…
A: Step 1: When acetic acid (CH3COOH) reacts with KOH to form potassium acetate (CH3COOK), a solution…
Q: Draw the structure of a dinucleotide formed by joining the 3'-OH group of dGMP to the 5'-phosphate…
A: Here is a structure of the dinucleotide formed by joining the 3'-OH group of dGMP to the…
Please solve - no AI answers
Step by step
Solved in 2 steps
- Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?HindlII ECORI ECORV BamHI 379 Sall Pstl. tet amp Plasmid PBR322 1000 4361 bp ori Ndel If you were going to use this vector to clone a foreign fragment of DNA, what two restriction enzymes would you use to cut the vector, so you could make a recombinant plasmid that has AmpR and KanR (Kanamycin resistance), but No TetR. Assume the insert DNA does NOT have a Tet resistance gene but does have a Kanamycin resistance gene. O EcoR1 and Hindll O Pst1 and Sal1 O Pst1 and Nde1 O EcoR1 and Nde1 f6Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
- How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How many fragments and how big each fragment should be after digesting the plasmid with PvuI? How many fragments and how big each fragment should be after digesting with both enzymes? Show your calculation/explanation.See imageYou wish to insert a gene in the plasmid below. (Note the neon green lines represent restriction sites.) amp gene BamHI Sacl Saçl EcoRI BamHI 33 BamHI Gene of interest Chromosomal DNA from human cells a) Which restriction enzyme should you use to cleave the plasmid? Explain your answer. b) How would you create a cDNA library for the chromosomal DNA containing the gene of interest? c) The green area on the plasmid is the ampicillin resistance gene. Explain how you would use it to screen for a recombinant plasmid. 1
- A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHIB 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairsEcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
- U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIPlease don't provide handwriting solution