Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…
A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…
Q: Which of the following statements are true? O Each stop codon also codes for an amino acid O Each…
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…
Q: Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end…
A: The anticodon is found at the 51 end of the tRNA molecule. An amino acid binds to 31 end of the…
Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…
A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…
Q: How is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying…
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…
Q: Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence…
A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: A tRNA with the attached amino acid is referred to as “charged.” The amino acid is added at which…
A: The tRNA is the transfer RNA that transfer the amino acids to the growing polypeptide chain. The…
Q: What are the possible codons that a tRNA molecule could interact with if it is carrying each of the…
A: A codon is a triplet nucleotide of DNA or RNA corresponding during protein synthesis to a particular…
Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…
A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…
Q: Look up a standard genetic code table, how many codons will be recognized by tRNA charged by…
A: Introduction A gene can be defined as sequence of bases that encodes a functional protein molecule.…
Q: Which two functional groups are present in an amino acid? Immersive Reader a Amino and carboxyl…
A: Proteins are linear polymers that are built of monomer units known as amino acids. Nearly 500 amino…
Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…
A: CODON- It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.
Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…
A: The given DNA template is TACGATCCGAACCAAACT The mRNA template would be AUGCUAGGCUUGGUUUGA When…
Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…
A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…
Q: An anticodon has the sequence GCG. What amino acid does this tRNA carry? What would be the effect of…
A: Anticodon is a sequence of three nucleotides on a tRNA molecule that bind to a specific…
Q: Describe the structural features that all tRNA molecules have in common.
A: Introduction tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…
Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…
A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…
Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU
A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…
Q: Which of the following is true regarding the tRNA structure? The anticodon is found at the 5′ end…
A: Answers : The anticodon is found at the 5′ end of the tRNA molecule. Anticodon is found in the…
Q: Which of the following nucleotide triplets best represents a codon?
A: Introduction:- A codon is a triplet of bases (or nucleotides) in the DNA coding for one amino acid.…
Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…
A:
Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which of the following statements regarding the genetic code is false? The genetic code is…
A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…
Q: In addition to variable sites, the strucutre of a tRNA includes
A: tRNA tRNA or transfer RNA, sometimes referred as sRNA, is a adapter molecule which read the codon…
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…
Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…
A:
Q: Which of the following statements best explains why there are many more codons than there are amino…
A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…
Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…
A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…
Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…
A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…
Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…
A: Peptide formed from given mRNA sequences.
Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…
A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…
Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?
A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…
Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…
A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…
Q: Which of the following enzymes adds a new amino acid to the growing chain of a protein during…
A: Introduction Protein Translation: the process of reading mRNA and synthesis of a peptide chain of…
Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…
A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…
Q: Which of the following statements about tRNA molecules is TRUE? Multiple Choice TRNA assumes a…
A: A transfer RNA or tRNA is a special kind of RNA molecule. Work of it is to match an mRNA codon…
Q: Why are 3 nucleotides needed for a codon? Because one nucleotide is redundant Because…
A: There are five nitrogen bases - adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U).…
Q: For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which…
A: During translation, codons in an mRNA are read, starting with a start codon and continuing until a…
Q: The tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair…
A: Normal complementary nucleic acid sequences bind to each other by Watson and Crick base pairing but…
Q: NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that takes role in the creation of…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…
A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The…
A: The single-stranded RNA is called messenger RNA. The ribosomes read an mRNA when making proteins.…
Q: Match each term with the most appropriate description. sites for polypeptide assembly binds to…
A: All cells have the translation process resides within a specialized organelle which is known as the…
A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's anticodon?*Hint: The codons below do not need to be read from left to right. Use the 5' and 3' directionality to pick out which of the following is the correct answer.
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon table as needed. 5'-AUU-3' anticodon: 3'- -5' amino acid: 5' -UCU-3' anticodon: 3'- -5' amino acid: 5' -CAG-3' anticodon: 3'- -5' amino acid:Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
- The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.
- A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair. Q. 5′ –CAG–3′Consider the following 2 codons sequences. Codon sequence 1: ACU AGA GAU GUC UGC Codon sequence 2: GCG GAG AAA UGG UAU Draw an anti-parallel b-sheet that can be formed between the amino acids from the two codon sequences.Write all possible codons recognized by each of the given anticodons. An anticodon strand reads 5'-UGA-3'. Fill in the missing base sequences for the possible codons recognized by the anticodon. Codon: 5- Codon: 5'- -3' Codon: 5'- -3' An anticodon strand reads 5'-AUU-3'. Fill in the missing base sequences for the possible codons recognized by the anticodon. -3'
- Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand. tRNA UAA CCA UUA UAA mRNA Amino Acids AUU = isoleucine AAU = asparginine GGU = glycine GUC = valine GAG = glutamic acidThe sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’