A primer has annealed to the template DNA below in the position indicated. Which nucleotide will be the first to be covalently added to the free 3' hydroxyl (-OH) of the primer by DNA polymerase? (choose one) primer 5'-CCCAGCTCCACTAGCG 3'-GGGTCGAGGTGATCGCGTTCGATATATCCATGGCCTAAACACATG template dCTP

A primer has annealed to the template DNA below in the position indicated. Which nucleotide will be the first to be covalently added to the free 3' hydroxyl (-OH) of the primer by DNA polymerase? (choose one) primer 5'-CCCAGCTCCACTAGCG 3'-GGGTCGAGGTGATCGCGTTCGATATATCCATGGCCTAAACACATG template dCTP

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Below is an image of a dilution that was performed. The volume above each arrow indicates the volume…

A: To solve these questions, let's break down the dilution process and then calculate the…

Q: 62) If you want to inhibit protein synthesis on the transcriptional level you would use: a)…

A: 62) Approach to solving the question:This question revolves around understanding how different…

Q: The general public takes for granted the link between an infectious agent and a given infection…

A: Detailed explanation: Establishing Causal Relationships in Infectious Diseases: The Significance of…

Q: Detail the molecular pathophysiology that leads to cystic fibrosis-related diabetes.

A: Cystic Fibrosis-related diabetes (CFRD) is a common and important complication of cystic fibrosis…

Q: Jane Doe’s deceased body was found at her dining room table. Her death was considered suspicious.…

A: Cyanide is a highly harmful chemical compound that poses extreme wellbeing dangers and is often…

Q: Which of the following is a genotypic frequency? O aa = = 24% O A= 54% O a = 46% O Brown hair = 33%

A: To determine which of the given options represents a genotypic frequency, let's review what…

Q: Size Options: P20 P200 P1000 P5000

A: Micropipettes are common laboratory instruments used to accurately measure and transfer small liquid…

Q: Please answer both thank you!

A: 11)Answer:Centrifuges are workhorses in blood analysis, utilizing the principles of circular motion…

Q: Viruses are obligatory parasites. When bacteriophages infect a cell, there would be two possible…

A: Detailed explanation:Structure of T-even Bacteriophage:The T-even bacteriophage, a member of the…

Q: What is the relationship between extinction, its impact on biodiversity, and ecosystems?…

A: The question is asking about the relationship between extinction, biodiversity, and ecosystems.…

Q: two reasons as to why it is important to understand genetics in everyday life

A: The first reason why understanding genetics is important in everyday life is because it helps us…

Q: Contrast experimental and statistical analyses of cumulative selection in proteins.

A: Cumulative selection in proteins may be a crucial concept in molecular science that relates to how…

Q: The reason the elasticity and surface tension of the lungs do not cause the lungs to collapse…

A: Elasticity and Surface Tension: Lungs have elasticity, meaning they have a tendency to recoil or…

Q: Very often, the invasion of hosts by pathogenic microbes leads to infections. Discuss the different…

A: Microorganisms have evolved various means to enter and colonize a host, leading to infections. These…

Q: Genetics Q7

A: Based on the information that has been provided, it is not possible to tell which children are the…

Q: Answer the following questions about insulin: Describe DNA methylation and how it impacts gene…

A: Approach to solving the question:Read and understand the question.Answer the questions by…

Q: how did your heart rate change with body position? when was it the lowest? highest? Use the heart…

A: Key references:https://www.kenhub.com/en/library/anatomy/heart

Q: Describe two global challenges to developing, distributing, and/or administering antiparasitics.

A: Let's talk about the two world problems that come up when making, distributing, and giving out…

Q: which of the following models represents the genetic material that controls inherited traits

A: The DNA model is the model that represents the genetic material responsible for inheriting traits.…

Q: If one of the planets in our solar system averages 0.723332 astronomical units from the sun, what is…

A: The objective of the question is to calculate the orbital period of a planet in our solar system…

Q: What is the advantage of homology-directed repair (HDR) ?

A: One of the most vital cellular processes called homology-directed repair (HDR) is capable for fixing…

Q: Examine the Following key words and examples on the left. Drag the choice from the right that best…

A: Primary Succession: This occurs when a community establishes itself on a previously uninhabited…

Q: Explain how silent mutations affect the structure and function of the protein.

A: Detailed explanation:Silent mutations are called "silent" because they occur in a gene's DNA…

Q: What is the correct order of segmentation of genes? Morphogen, Pair-Rule, Segment Polarity, Hox, Gap

A: Approach to solving the question:Read the question carefully.Identify key information.Correct the…

Q: What is Lc-Ms-Ms System?

A: The combining of the separating capacity of liquid chromatography with the very selective and…

Q: hat is the dose in mSv for 2.5 mGy of neutron exposure to the eye?

A: To calculate the measurements in millisieverts (mSv) for neutron presentation, especially to…

Q: 1. The Petri Dish method is used in microbiology to raise bacteria in: a) rapid growth b) pure…

A: Key references: Books

Q: i need help with how to write out the formulas and how to get the exact graph here's the photo.…

A: Calculating the Initial Slope The initial slope is a representation of the rate of change in the…

Q: Which statement is not true of the chytrids? (a) they are simple aquatic fungi (b) they produce…

A: Chytrids are a special bunch of fungi distinguished by their primitive characteristics, which…

Q: Annabeth and Percy are concerned about having a child with Niemann - Pick disease, which causes…

A: Understanding the Inheritance Pattern:Niemann-Pick disease is an autosomal recessive disorder. This…

Q: Number of individuals 10 8 6 4 64 2 0 6 On balloon vine fruits Beak- Museum-specimen average On…

A: Detailed explanation: Natural selection decreases beak length in soapberry bug populations: This…

Q: In 2019, a couple died from plague after eating uncooked rodent spleen (a delicacy where they were…

A: The symptom set that characterizes both plague and Ebola includes high fevers, sore throat, and…

Q: Explain the reasons why the Poon Choi is the high risk food for the elderly? It would be easily…

A: 1. Lack of thermal stability: Poon Choi is a dish with multiple ingredients cooked together, making…

Q: Water absorption by roots is under the influence of

A: Transpiration is a process through which the loss of water takes place from the exposed parts of the…

Q: What is the medial forebrain bundle? Discuss the evidence for and against its involvement in reward.…

A: The answer provides an in-depth overview of the medial forebrain bundle (MFB), elucidating its…

Q: The dog breed West Highland Terrier is a product of artificial selection. Give a brief description…

A: Please see the answer section.

Q: Describe the difference between relative and absolute dating, making sure to give an example of a…

A: The objective of this question is to understand the difference between relative and absolute dating,…

Q: The Spotted Lanternfly (Lycorma delicatula) is endemic to China and was first identified in the…

A: here is the graph. . Here's a detailed breakdown of the graph and its features:### Y-axis:…

Q: The table below shows four organisms and the biological processes each uses. Select the organisms…

A: Approach to solving the question: Detailed explanation: Examples: Key references:

Q: Mating Ste12 Tec1 Budding 17. (8 points) Scientists are studying the transcription factors Ste12 and…

A: Combinatorial control is a regulatory mechanism in gene expression where multiple transcription…

Q: What, if any, are potential restriction enzyme recognition sequences in this DNA? (Only consider…

Q: ons: On They will select and present a label for a pet food. They will identify on the label each of…

A: 1. **Main Display Panel** - This is typically the front of the package and includes the brand and…

Q: Which of the following satements are true? Reduction in FGFR signalling leads to achondroplasiaPTCH1…

A: The true statements are: "Excessive FGFR signalling leads to achondroplasia". Aberrations in the…

Q: Which of the following best describes superantigens? O Superantigens are a class of antibodies that…

A: Which of the following best describes superantigens? Brief explain each options why true or…

Q: Gram type your answer... bacteria have a thick layer of peptidoglycan and a single membrane layer.…

A: Step 1: Step 2: Step 3: Step 4:

Q: Analyze the impact of the Physician Self-Referral Law on a healthcare organization’s reimbursement,…

A: Introduction The Physician Self-Referral Law, commonly known as the Stark Law, prohibits physicians…

Q: Hiiiiiiiiiii

A: There is a strong connection between genetics and sexuality, with sexuality playing a substantial…

Q: The measles virus has a basic reproduction number (R0) of 15. To achieve herd immunity, what…

A: The basic reproduction number (R0) represents the average number of new infections caused by a…

Q: Discussion 1 pts Meets Standards A complete and accurate description of the difference between…

A: *In genetics and cell biology, homologous chromosomes and sister chromatids are fundamental ideas.…

Q: Can u give me the correct answer

A: Solution: (information required was not provided. One possible food web is provided in the image…

Question

Can someone example why it’s dctp im confused ;&;;$;;$;$$:

A primer has annealed to the template DNA below in the position indicated.
Which nucleotide will be the first to be covalently added to the free 3'
hydroxyl (-OH) of the primer by DNA polymerase?
(choose one)
primer
5'-CCCAGCTCCACTAGCG
3'-GGGTCGAGGTGATCGCGTTCGATATATCCATGGCCTAAACACATG
template
dCTP

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Length
Please explain why the order is 3–1-4-2 and not another way, thank you so much. Question is in the image.
Hello, I have already asked for help with this question but whoever answered it copied the DNA Template strand down I correctly. Please see picture below and send correct Amino acid sequence. Thank you , gwen
Using the numbered sites on the DNA double helix strands below, where would the DNA Primer ACTTGCGA bind to for DNA Amplification?
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 only
Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.
You prepare a reaction mix containing (i) DNA polymerase III, (ii) DATP, DCTP, dGTP, Mg2+, and 2,3'dideoxy-TTP (called ddTTP*), (iii) a short primer with the sequence 5'-CCTG-3, and (iv) a source DNA fragment with the sequence, 5'-AATCGTTCACGTTAGCAGG-3. What is the product of this reaction? Note that in ddTTP, both the 2' and 3' positions on the ribose sugar lack hydroxyl groups. No reaction, because the primer is not complementary to any sequence in the source DNA. O CCTGCT O CCTGC O T'T'AGCAAGT'GCAAT CGTCC O CCTGCT'AACGT GAACGAT'T
Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.