A new chemical pesticide developed for agricultural use was subjected to the Ames test. The results are as follows: Sample Number of his* revertent colonies distilled water distilled water + rat liver enzymes 3 pesticide 125 pesticide + rat liver enzymes 127 Which of the following statements could you make about this pesticide? O The pesticide is modified by liver enzymes. O The pesticide is unlikely to be a mutagen in itself. O The pesticide may be protective against spontaneous mutation. O The pesticide is a mutagen O 1 and 4 are correct

A new chemical pesticide developed for agricultural use was subjected to the Ames test. The results are as follows: Sample Number of his* revertent colonies distilled water distilled water + rat liver enzymes 3 pesticide 125 pesticide + rat liver enzymes 127 Which of the following statements could you make about this pesticide? O The pesticide is modified by liver enzymes. O The pesticide is unlikely to be a mutagen in itself. O The pesticide may be protective against spontaneous mutation. O The pesticide is a mutagen O 1 and 4 are correct

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The following chromatogram is obtained from the sequencing reaction. Using the key below, what message did you integrate into the yeast genome? AATATTAAAGTATAGAACGACTGTGAA A B с D E F G H I AAA AAT AAG AAC ATT ATG ATC AGT AGG J K L M N O P Q R Key GGG GGA GGT GGC GAA GAC GAT GTT GTA S T U V W X Y Z (SPACE) TTT TTC TTA TTG TGT TGA TGG TAA TAG
Answer the question in the photo
We isolate DNA from a bacteria that is wild type for the genes arg leu and his shear it in a blender mix it into a culture of bacteria that is mutant for the genes arg leu and his . We then plate on various media. These are the results: Media with arginine 20 colonies /ml Media with histidine 300 colonies /ml Media with leucine 500 colonies /ml Media with all three 10000 colonies/ml 21. What is this experiment called? A. transpiration B. conjugation C. transformation D. transduction
When Avery and his colleagues had obtained what was concluded to be the transforming factor from the IIIS virulent cells, they treated the fraction with proteases, RNase, and DNase, followed in each case by the assay for retention or loss of transforming ability. What were the purpose and results of these experiments? What conclusions were drawn?
In your opinion, is antibiotic use at farm sites promote the development and spread of antibiotic resistant genes in bacteria? Why or why not please explain based on the article
Three mutations were obtained in a bacterial gene. An antibody is available for the protein product of this gene. Both Northern analysis (RNA separated by electrophoresis, blotted, and probed with DNA) and Western analysis (proteins separated by electrophoresis, blotted, and probed with antibodies) were performed on the mutants. The results are summarized below. Northern Size Western Size 1 2 3 1 2 3 + Long Short Short Long For each mutation, what kind of mutation occurred and how do you know? a) Mutant 1 b) Mutant 2 c) Mutant 3
What is the purpose of the rat liver extract in this procedure?
You need to complete the following steps for an experiment. Explain whether an acrylamide gel or an agarose gel is more appropriate to use for the following experiments. Purifying tRNA from total RNA Isolating a vector insert for cloning Analyzing PCR products
Why do some cells grow on the control plate in the absence of a mutagen?
Please answer the following questions using numbers and not text. For example, if you think the answer is 24, write 24 and not twenty-four. If you think the answer is 24 ATP, write only the number 24. As a microbiology technician, your job is to characterize a novel bacterial strain isolated from insects. Phenotypically, you have discovered that the new bacterial strain can grow in the presence or absence of oxygen. After genome sequencing and biochemical characterization, you know that your new organism is capable of making all of the enzymes necessary for glycolysis and the TCA cycle, and that it has an electron transport chain. Answer the following questions based on the growth of your organism on minimal media plates containing only acetate as a carbon and energy source. Acetate is transported across the membrane at the cost of 3 ATP per molecule. Each question should be answered based on the metabolism of one molecule of acetate. If you come up with a negative value, indicate an…
Which of the following plates could represent the results of the transformation experiment with PGLO when plated on LB/Amp, if the experiment was successful? Refer to the letters on top of the image. Ignore the letters at the bottom. A B OB O none of the choices are correct