9. Which of the following enzyme catalyzes a reaction that introduces reduced nitrogen ito cellular metabolism? a) Bacterial glutamine synthase b) Bacterial dinitrogenase reductase c) Bacterial dinitrogenase oxidase d) Phosphatase

9. Which of the following enzyme catalyzes a reaction that introduces reduced nitrogen ito cellular metabolism? a) Bacterial glutamine synthase b) Bacterial dinitrogenase reductase c) Bacterial dinitrogenase oxidase d) Phosphatase

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Draw every step involved in the chemical synthesis of the dinucleotide (5')CG(3'). Show molecular…

A: The nucleic acid is a macromolecule that is found in all living organisms and the DNA is a class of…

Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (???? ?) in newly synthesized…

A: The DNA that makes the genetic material for all prokaryotes and eukaryotes is nothing but a code for…

Q: A B C Microbe Y only D Microbes Yand Z Microbes X and Z Has its own ribosomes Scientists took an…

Q: Compare and contrast proteins and nucleic acids. What do these biomolecules have in common? In what…

A: Biomolecules are considered one of the most essential parts of a body. Biomolecules help in…

Q: TRANSLATION: Antibiotics are drugs that are bacteriostatic or bactericidal. Both antibiotic types…

A: Antibiotics are broadly classified as bacteriostatic and bactericidal. Bacteriostatic: These…

Q: 16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange factor. Explain why elIF2B…

A: The eukaryotic initiation factor elF2B is the guanine nucleotide exchange factor, which converts…

Q: The table below shows a sequence of activities du Order Activity 1st Nitrogenous base sequences…

A: Macromolecule : It is a large , complex molecules . They are composed of thousands of molecules of…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: I’m kinda confused on what to study for the test and what questions are gonna be on there but this…

A: In the given slide , they wants to explain you about bacterial chromosome which is different from…

Q: 1.Which is the correct statement: Speed of protein synthesis > speed of protein folding Speed of…

A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…

Q: Identification. a)Carrier of the activated amino acids to the ribosomes for incorporation into the…

A: Ribosome is the translational machine that reads the codons on the mRNA and with the help of…

Q: 12. Polenske value of fatty acid indicates A. how much unsaturation is there in the fatty acid B.…

A: Volatile fatty acid : Linear small(short chain) aliphatic mono-carboxylate compound, like the acetic…

Q: 1. Analyze the following and identify which one mentions the function of a common eukaryotic ligase?…

A: Enzymes are protein-based biomolecules. They accelerate chemical reactions. They participate in a…

Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Part I. Answer the following questions in 5 to 7 sentences. 1. What are pentoses? What are the roles…

A: Carbohydrates are also known as hydrates of carbon. They contain elements such as carbon, hydrogen,…

Q: 1. Analyze the following and identify which one mentions the function of a common eukaryotic ligase?…

A: Ligase enzymes are enzymes of Enzyme classification class 6 and it catalyzes the formation of C-C,…

Q: Bacteriology 12. Indicate whether the following statement about the antibiotic metronidazole is TRUE…

A: Answer :- True.

Q: Why is the improved synthesis of nucleotide triphosphates more environmentally benign? Check all…

A: The building blocks of nucleic acids are…

Q: BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : The antibody-antigen binding site…

A: The function of proteins are crucially dependent on protein-ligand interactions.

Q: DNA RNA PROTEIN

A: The central dogma is a molecular biology process that converts DNA to RNA and creates a functioning…

Q: What are the correct complementary RNA bases for the strand shown here? TUUCTG UAACUG TAACTG CHOICE…

A: Ribonucleic acid (RNA) is genetic material for some of the viruses. Unlike the DNA it is single…

Q: 3. Which of the following is false? a) Methyl, phosphoryl, adenyl, uridylyl and adenosine…

A: Enzymes are basically proteins that are intricately packed within with the help of intramolecular…

Q: Briefly describe four ways in which a protein could be denatured.

A: Denaturation is a process in which proteins lose their native conformation i.e. normal, biologically…

Q: Need help, please. Please answer the following four questions to the image I attached. 1. You…

A: The restriction enzymes are specific endonuclease that are responsible for cutting double stranded…

Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…

A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…

Q: List all the cellular components (organelles and structures) involved in the proteins production.…

A: The study of the formation, functioning, and behavior of cells is known as cell biology. Cells are…

Q: Acyclovir is best said to be a / an: Select one: O a. nucleoside Ob. nuclear base C. MRNA drug Od…

A: Acyclovir : Acyclovir is an antiviral medicine generally used for the treatment of viral diseases.…

Q: 1. Using the different criteria listed in the table, differentiate prokaryotes and eukaryotes.…

A: A cell is the basic structural and functional key of life. A cell has multiple organelles that carry…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: Q2. Which of the following molecules best fits the following NMR spectrum? C9H12 4 ppm

Q: 2. Comprehend the following statements and identify which one describe ribosomes FALSELY. A. Parts…

A: Ribosomes are intricate cellular organelles. Protein synthesis is heavily reliant on their…

Q: 1.) What are the main structural features of the mucupolysaccharides chitin? 2.) How do this aid in…

A: Chitin is a carbohydrates polymer that is composed of N-acetyl D-glucosamine units attached together…

Q: Yu raach aitantin a ab tht studies mucleic acids. Your advisor gave you four tubes for analysis.…

A: Each organism have a genetic meterial by which they regulate, inherited and constant their…

Q: Under what conditions, a higher rate in the presence of the inhibitor observed? (how could the…

A: There is a gradual increase in reaction rate because competitive inhibitors are occupying only some…

Q: 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following…

A: Mutations When the sequence of DNA is altered it is said that the DNA is mutated. Mutations causes…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: 3. Bacterium Z had the lab results below. What can you tell me about the protein metabolism of this…

A: Microbiology is the branch of biology that deals with study of organisms that are too small to be…

Q: Which of the following functions describes the enzyme Peptidase? A. remove phosphate from a…

A: Peptidase are enzymes that comes under the category of hydrolase that is class 3 of enzymes i.e.,…

Q: QUESTION: What is an amphipathic molecule? Explain. Where is it often found? Explain.…

A: QUESTION: What is an amphipathic molecule? Explain. Where is it often found? Explain. What is its…

Q: mRNAs undergoing degradation are often localised to: Processing bodies Lysosomes Mitochondria The…

A: mRNA degradation is a cellular process that involves the breakdown and removal of messenger RNA…

Q: Assignment 9: Transcribing and Translating a Protein Activity 5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: please explain whats going on of the following figure

A: Aptamer These are sequences of single-stranded DNA or RNA that have the ability to bind an…

Q: Single digest - Cla I What is the number of fragments? What are/is the size(s) of fragment(s)?

A: ClaI is a restriction endonuclease obtained from Caryophanon latum. Its recognition site is a…

Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…

A: The genetic instructions that are included in a cell's genes can only be read out, or expressed,…

Q: Protein synthesis steps made simple? Step by step to memor

A: Protein synthesis, also known as translation, is the process of creating a polymer of an amino acid…

Q: QUESTION 1 Shown below is the 5' end of an mRNA. Translation of this mRNA should begin at nucleotide…

A: mRNA consists of different three nucleotide codons that will eventually code for different amino…

Question

IX - BIOMOLECULES Instructions : - Answer the question properly. - Please do not copy here in Bartleby - Explain why did you choose that answer in 3-5 sentences.

9. Which of the following enzyme catalyzes a reaction that introduces reduced
nitrogen ito cellular metabolism?
a) Bacterial glutamine synthase
b) Bacterial dinitrogenase reductase
c) Bacterial dinitrogenase oxidase
d) Phosphatase

Carbon-based molecules made by living things. The four categories of biomolecules—proteins, lipids, nucleic acids, and carbohydrates—compose living things and carry out their chemical processes.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Antimicrobial Corning®Gorilla®Glass Protein Synthesis IT Uonsan Review Base your answer to the question on the diagram below, which represents a process that occurs in living cells, and on your knowledge of biology. Newly formed molecule Glycine Arginine Proline HAlanine Glycine CỦA MRNA Structure X The process shown in the diagram is 1. cellular respiration 2. cellular reorganization 3. gene recombination 4. protein synthesis Zoom: Standard EX Note Bookmark Eliminator Highlighter P Line Reader Calculator Ruler Reference Protractor Coming soon
HBOCPS Das X + Orders - X ← → C D Login OCPS Performance Matters Question 5 of 16 Question 1-5 lipid bilayer low concentration Performa X < Previous olaocps.performancematters.com/ola/ola.jsp?clientcode=flocps# Join a Game - Quizizz K! Play Kahoot! - Enter... Dashboard Submit Test 1 channel protein Educator 3 2 x 12 Exam: 01 × Plans for x carrier protein 3 The diagram below shows three different proteins embedded in a cell membrane, as well as the concentration gradient surrounding the cell. high concentration POREI ***** energy Performance Matte... AP EL U.S. Citize X FLVS Login My Quizzes - Quizizz Welcome, Asheley! 02.Cl.Biology.CRM3.2_2023 EL https://sex S4JypvF Which of the following statements correctly states the process shown in the diagram? O The process labeled 1 shows how cells can easily move molecules with the concentration gradient using high energy molecules. The process labeled 2 shows how cells move molecules against the concentration gradient without needing high…
Please help me with this question within an hour?
Hand In As × Bio30U02L04LegoExemplar.pdf x Q BIO181 Chapter 10 Mastering B x G Which of the following Pattempt-749621&cmid=2876278page=2 Mental Wellness Supports Use the codon wheel below to answer the following question. Glycine Glutamic Aspartic acid Alanine Valine G Arginine A Serine Lysine C U 520601 Phenyl- alanine Leucine Serine UCAG UC AG UCAG GU A C UGU GA ט כ GAC A C C A C G U GROJ GAGUGACU GACU GA CU G400 Asparagine Threonine UGA Methionine Isoleucine Tyrosine U C Stop Cysteine A Stop G Tryptophan Leucine Proline Histidine Glutamine Arginine If the nucleotide sequence of an anticodon was AUC, then the DNA triplet would be: 10 H O TAG Out of O ATC O AUC On 11 red O UAG ۵ Thinking about the structure of DNA, how might you use radioactive phosphorus to demonstrate compound, that is what was added to the R strain to allow it to become virulent, of bacteria in Gri supporting the notion that DNA, not proteins, are the unit of heredity.
9:54 AM Done Prelab 7 - Tagged (2 of 64) 三: Prelab 7 - Protein Catabolism In this lab we focus on another important group of metabolism processes: the breakdown of proteins and amino acids. In these labs we will utilize a series of media in tubes that differ in the protein for the bacteria to breakdown, and in the end products they can detect. There are a few new vocabulary terms. Proteolytic enzymes are enzymes that breakdown proteins, usually by first breaking apart the polypeptide into individual amino acids. Hydrolysis reaction is used to break apart the peptide bond holding the amino acids in the polypeptide together. Hydrolysis is used to breakdown urea, a compound produced by the body from the destruction of proteins. Once broken down to individual amino acid, often the amine (NH2) functional group is broken off one end in a deamination reaction, creating NH3. In a decarboxylation reaction the carboxyl group is removed, creating CO2. In a desulfuration reaction a sulfur is…
please answer clearly and explain. do not copy. thanks
Urgently needed
BIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: 1. Use the following base sequence of one strand of an AATTGAACACATGCGCCC. imaginary DNA molecule: 2 Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. 3. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. 4. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. 5. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step 4 mRNA from Step 5…
In 2 paragraphs. Discuss the differences between RNA and DNA, in terms of structure and function. Identify the difference in the nucleobase of RNA from DNA.
Question: Write the sequence of nucleotides in the blanks below and include 5' to 3' labels to show the firection of the strand: Dna: 3' T-A-C C-A-G 5' mRNA: 5' _-_-_ _-_-_ 3' Fill in the blanks.
Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is added to the DNA sequence above.
anline State- estid%3D1740&strandid%3D&element3D&difficulty=Dassessment&assignment_id%3D42985127&load_test=1&teacherPreview=#test Save Subm gp120 Docking Glycoprotein Lipid Membrane RNA gp41 Transmembrane Glycoprotein Сapsid Matrix Reverse Transcriptase Viruses, although not considered to be alive, attack host cells and cause disease. The attack of a host cell is necessary for the virus to survive for all of the reasons listed EXCEPT one. That is they cannot synthesize proteins becayse they lack ribosomes and must use the ribosomes of their host cells to translate viral messenger RNA into new Eliminate proteins. A) they cannot produce or store energy in the form of ATP and have to get their energy from the host cell. B) they parasitize the host cell for basic molecules like amino acids, nucleotides, and lipids. D) they lack DNA/RNA so they must use the DNA of the host cell. Address 立