Q: M Assignment Due... New Tab ... A dung beetle is peacefully rolling the ball of dung she made. She…
A: Ans- the correct answer for the following question is C) intraspecific interference. When any…
Q: Discuss the genetic engineering of nodulation genes and the molecular events that occur during…
A: * Nodulation is an host specific process where rhizobium will be having a defined host plant range.…
Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: Pluripotent stem cells are the cells which can be developed into any type of the cell in the body .
Q: All of the following are functions of connective tissues, except energy and mineral storage.…
A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…
Q: Read the images given before answering the question below. Identify the two common diseases that…
A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…
Q: Which vertebra has odontoid process? a) Atlas b) Axis c) Cervical d) Соcсух
A: Introduction The odontoid process is a protuberance of the second cervical vertebra, It exhibits a…
Q: you have isolated a Bacillus species and would like to test its plant growth promoting abilities.…
A: Bacillus is a genus of bacteria which includes gram-positive, spore forming, rod shaped aerobic or…
Q: Immune-mediated myositis (IMM) is a muscle wasting disease that occurs in quarter horses with an…
A: Given information IMM or immune-mediated myositis is a muscle-wasting disorder. The mutation is…
Q: A) Two linked genes, (A) and (B), are separated by 18 cM. A XY individual with genotype Aa Bb…
A: If the genes are located on the same chromosome then they are classified as linked genes. In this…
Q: Why does a muscle cell express a different set of genies compared to a white blood cell? Why do…
A: The muscle cells and the white blood cells comprise different sets of genies depending on different…
Q: What is cellular regeneration? How is mitosis related to this process?
A: Introduction - Non-injured tissue in humans regenerates normally over time; by default, new…
Q: Define developmental biology
A: Biology is a field of science that deals with learning of living organisms . There are several…
Q: The small, monomeric protein Rho has acquired a mutation by which it is constitutively activated and…
A: * Mutations in gene for rhodopsin that is RHO will cause autosomal dominant retinitis pigmentosa…
Q: discuss how ACC deaminase containing plant growth-promoting bacteria facilitates plant growth and…
A: Plant growth promoting bacteria effect the growth of plants :-
Q: A roach crawls across a dirty floor and onto uncovered food. An unsuspecting person eats the food…
A: Transmission of various microorganism by vectors is very common as vectors act as a vehicle for the…
Q: What additional tests could be used to examine evolutionary relationships among mollusks
A: Mollusca is a phylum of soft-bodied, shelled animals with an unsegmented coelomate body divided into…
Q: Which part of a cell allows nutrients and other material to enter or leave the cell ?
A:
Q: True or false and explain why. According to the Goldman equation, resting membrane potential of a…
A: * Goldman equation also called as Goldman Hodgkin Katz voltage equation that is used in cell…
Q: n a particular human population, the MN blood group frequencies were as follows: Genotype: MM MN NN…
A: The Hardy-Weinberg equilibrium is a way to determine if a population is in equilibrium. The equation…
Q: Why doesn’t gastric juice destroy the stomach cells that make it?
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: Can you determine the source of contamination (for example, human, domestic animal, or wild animal)…
A: Contaminants and contamination Contamination means the alteration in the original properties. Water…
Q: Hello please help Part 1: A cell has a nonsense mutation in the gene encoding TOM that prevents this…
A: Introduction A Mutation is a sudden change in genetic character, It occurs when a DNA gene is…
Q: Please answer and explain. Provide references if possible: TOPIC: PARASITES: SCOTCH TAPE SWAB…
A: Please follow step 2 for detailed explanations.
Q: 6. During an infection, the immune system alerts the organ systems of the body by producing…
A: An infection occurs when a germ enters a person's body and causes harm. In that person's body, the…
Q: Show the cross between a heterozygous purple flowered pea plant and a white flowered pea plant.
A: Heterozygous purple flower (Pp) Recessive white flower (pp) When we cross between these two…
Q: Green filamentous Slime molds Fungi Animals Entamoebae Gram+ bacteria Animals Spirochetes Chlamydiae…
A: Phylogenetic tree is the representation of how organism evolves from a common ancestor.
Q: Identify the structures that make up the skin described below. Use the drop down menu to select the…
A: The structure that produces hair called hair follicles ( G) . The dermis is structure E in the…
Q: the differences between THT and SMT PCB fabrication
A:
Q: The region of chromosome that are located at the ends of chromosomes, and needed for chromosomal…
A: Note- As per Bartleby rules, we are supposed to answer only first question, kindly repost the other…
Q: Use the graphs to answer the question below. In each of the figures, the x-axis represents time, and…
A: The predator-prey relationship is made up of interactions between two species and the impact they…
Q: What are multiple alleles? What is multiple allelism? Give examples to further understand the…
A: Please follow step 2 for detailed explanation.
Q: Assume tu inoculated 100 facultative anaerobic cells unto nutrient agar and incubated the plate…
A: Microorganisms are categorized based on the requirement of oxygen in the media. Obligate aerobes…
Q: Why does the genus Streptomyces of the Actinobacteria clade secrete chemicals (antibiotics) that can…
A: Streptomyces is the largest genus of the Actinomycetota and the type genus of the family…
Q: What is the purpose of ethanol in the procedure of staining fecal smears?
A: Staining of stool samples is very important in identifying parasites because it helps in detecting…
Q: 1. Dark shade? 2. Dark notch? Light "dot"? 4. Dark line? 5. Light line? 6. area? 7. Area? 8. entire?…
A: Embryology:- It is the study of the formation and development of an embryo from the stage of ovum…
Q: 21. DNA replication is A. Semiconservation B. Conservative C. Dispersive D. Heteroconservative 22.…
A: DNA is the genetic material of most of the living organisms. Any substances which are capable of…
Q: The Simian Immunodeficiency Virus (SIV), is an HIV-like virus that originally attacks the immune…
A: Some Important features of SIV (source :- Wikipedia ) Simian immunodeficiency virus (SIV) is a…
Q: Body too warm Body too cold Body Body cooler warmer Homeostasis is the control process that " keeps…
A: The homeostasis mechanism is responsible for maintaining a constant internal conditions in our body.…
Q: How is the mRNA strand altered during mRNA processing (the intermediate step between transcription…
A: RNA splicing occurs during or after transcription in nucleus for the nucleus encoded genes. It plays…
Q: Which of the answer choices is true about ATP synthase? Select all that apply. O ATP synthase makes…
A: *ATP synthase is a enzyme present in mitochondrial inner membrane and catalyzes the synthesis of…
Q: Tasmanian devils became extinct on the mainland of Australia probably because of competition for…
A: Species is a group of individuals that can mate together and produce viable offsprings.
Q: Fill in the blank sentences below: ________ is a protein-lined channel in the nuclear envelope…
A: After all the modifications such as the capping , splicing and polyadenylation , the active mRNA is…
Q: What role did the death of the dinosaurs play in primate evolution Please answer asap and type your…
A: Private server group of mammals with large body structure and complex brain as compared to other…
Q: Mark all on the following list that must occur for auxin to promote gene expression. ARF proteins…
A: These are the questions related to plant physiology and their biochemical reactions which causes…
Q: Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green…
A: The L-arabinose operon, commonly known as the ara operon, is a gene sequence that encodes enzymes…
Q: The major function of intervertebral discs is to a) Absorb shock b) String the vertebrae together c)…
A: Vertebral column is long twisted structure arises from base of brain that envelopes spinal cord . A…
Q: All of the following are functions of connective tissues, except energy and mineral storage.…
A: Introduction Cells, fibres, and a gel-like material make up connective tissue.
Q: What are the specific genetic tests used for Beta-Thalassemia?
A: Beta-thalassemia is a condition that can be inherited from one or both parents. It is a blood…
Q: Which of the following events likely impacted the survivorship of the 1920's cohort the Great…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: What proportion of energy stored at one trophic level ends up being LOST as it moves to the next…
A: The "trophic level" is simply a feeding level, as seen in a food chain or food web. The bottom…
Please solve this
![16. Eukaryotic initiation factor elF2B is a guanine nucleotide exchange
factor. Explain why elF2B would enhance the activity of elIF2.](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F03ec26b0-5a0f-4822-9d05-9bafbdfd2027%2F1f03eafb-158d-435f-8a38-0d6d0d02d164%2F6hniut_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Rifamycins have been used for the treatment of many diseases, including HIV-related Tuberculosis. Explain how Rifamycins inhibit the activities of bacterial DNA dependent RNA polymerase.The CTD of the largest subunit of RNA polymerase II can be phosphorylated at multiple serine residues. What are the conditions that lead to the phosphorylated versus nonphosphorylated RNA polymerase II CTD?Why can it be said that transcription of thebacteriophage T7 genome requires two enzymes?
- For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF 2 B. eIF4 C. eIF5GTP hydrolysis is used multiple times during the course of protein synthesis to advance the process forward, often irreversibly. Provide an example of a GTP-regulated step and its associated GTP binding factor that regulates a step during A) translation initiation, and also B) one that is associated with the translation elongation phase.Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′Trp operon of E. coli is an inducible sytem since it turns on in the presence of tryptophan. In most bacteria, protein synthesis is initiated with a modified methionine residue (N-formylmethionine), whereas unmodified methionines initiate protein synthesis in eukaryotes. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Write T if the statement is true and write F if the statement is falseThe following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!
- If the binding activity was purified, suggest two experimental approaches that could be taken to verify that this factor is in fact a transcription factor? Explain.During eukaryote transcription initiation, when TFIIE, TFIIA, TFIIB, TFIIF, and RNA pol II all join on the DNA strand, how do they know where to be put on the strand?Which serine in the CTD of RNA polymerase II is phosphorylated to recruit enzymes to add the 5’ guanosine cap? How is this phosphorylation different than the CTD phosphorylation in promoter clearance?
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)