5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this MRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect?

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: B14. The last two amino acids added to a polypeptide are - Trp - Glu - (C terminus). The last two…

A: To determine the last two anticodons used in the translation of the given polypeptide sequence, we…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: RNA sequence of A gene       If we have the following mutations, find the type of the mutation…

A:

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: The process of gene expression involves the process of transcription followed by the process of…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: In Figure 9-12(b), what do you think happens to thetRNA that is released from the E site?

A: t-RNA is responsible to bring the amino acids to the site of protein synthesis. t-RNA is charged…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…

A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Give typing answer with explanation and conclusion…

A: The production of RNA from DNA is known as translation that occurs within the nucleus of eukaryotic…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce  protein by the help of ribosome and tRNA.there are…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: Which of the following DNA mutations is almost certain to result in a shorter than normal protein?

A: In the present circumstance, we possess a DNA sequence and its equivalent mRNA sequence. It is…

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: In Figure 9-12, is the terminal amino acid emerging fromthe ribosome encoded by the 5′or 3′end of…

A: Translation is a process by which amino acids are linked together by peptide bonds thereby forming…

Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3

A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…

Q: Give the sequence of the LEFT (5'-end) region of this RNA strand that would participate in forming…

A: Answer: STEM LOOP = It is the hairpin loop , It occurs when the two regions of the same strand are…

Q: Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: Here we are given the 3'→5' directing strand of the DNA . This strand is the template strand. During…

Q: IX. Draw the structure of the polynucleotide below which corresponds to a codon in the mRNA that…

A: A nucleotide is compound made up of three components: a pentose sugar (ribose for RNA and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.