4. In E. coli, some core promoters have either a CAP binding site or an UP element in the DNA sequence immediately upstream of -35. Both DNA sequences can increase the rate of transcription from the associated promoter. A. What is similar about the way in which these two DNA sequences increase the rate of transcription?
Q: 5. Consider eukaryotic transcription: a) Draw a eukaryotic gene and label key sequences. (5 points)
A: A eukaryotic gene, consists of a set of sequences that appear in mature mRNA interrupted by introns.…
Q: 2. What does an operon typically consist of? a. an operator, a promoter, and a cluster of genes b. a…
A: Introduction :- An operon is a group of genes that are transcribed together to produce a single…
Q: a) Initiation of transcription in prokaryotes occurs at very specific sequences called promoters.…
A: Transcription in prokaryotes requires the DNA double helix to partially unwind in the region of RNA…
Q: 1. Which modification occurs as part of transcriptional termination? Explain this modification and…
A: 1 ) ANSWER The maturation of a eukaryotic mRNA from primary mrna transcript involve many complex…
Q: 3. During transcription: A. nucleotides are polymerized by DNA polymerase B. initiation occurs at a…
A: Transcription is the process of synthesis of RNA (mRNA, tRNA, rRNA) from the DNA which can further…
Q: 2. An enhancer, located upstream from a gene, has the following sequence: 5' – GTAG – 3' 3'- САТС -…
A: Enhancer is the region of gene sequence that can be recognized by the transcriptional factor or…
Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…
A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…
Q: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a…
A: The genetic material of a cell, that is, the DNA (deoxyribonucleic acid) contain various genes that…
Q: 1.The -glycosidic bond in uridine phosphate exist between a) C1 of ribose and N9 of uracil b) C3 of…
A: 1. The glycosidic linkage involves c-1 of sugar and the hydrogen atom of N-1 in uracil 2 Promoters…
Q: 6. By incubating cells with an inhibitor of TFIIH helicase activity. Which step in the transcript…
A: Answer - The initiation & the starting of the elongation process will be stopped if the cell is…
Q: 2. The following schematic shows the chromosomal location of Gene 1 and Gene 2. The corresponding…
A: g)It will not be same. The direction of transcription is always determined by the location of the…
Q: 3. Using the double stranded bacterial sequence provided below: ( - Indicate the promoter sequence…
A: All description given in this question though in brief transcription is a process where RNA produce…
Q: What is the central dogma? What are the compounds involved in this process? (Keywords: transcription…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Compare the control of gene regulation in eukaryotes and prokaryotes in terms of: a. transcription…
A: Prokaryotes and eukaryotes change their Gene articulation with respect to their environmental…
Q: 1.Promoters usually contain an AT-rich sequence. How is this beneficial to transcription?
A: Promoter is a specific site upstream of a gene where RNA Polymerase binds and initiates the process…
Q: 3. Explain the three stages of transcription in Eukaryotic cell. Identify all enzymes used with…
A: The transcription is the process by which mRNA is produced from the DNA template and during the…
Q: .Describe the process of transcription in prokaryotes, then explain how proteins can be targeted for…
A: The bacterial genome is comprised of circular DNA present in the cytoplasm and does not have…
Q: 5) The bacterial Lac operon is an example of transcriptional regulation. What are the major…
A: Using an example of Escherichia coli for the bacterial lac operon. Escherichia coli is a…
Q: The specific sequence component of the bacterial promoter located 10 base pairs upstream of the…
A: A promoter is cis-acting , position dependent DNA sequence which is necessary for accurate and…
Q: 3. Shown here is the structure of a human gene. = exons = introns Transcription termination site…
A: According to our guideline we can answer only first 3 subparts of a question. So, upload the…
Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression
A: Gene expression is the process by which a particular or a set of genes are expressed with the help…
Q: 3. You are investigating an abnormal eukaryotic cell line that makes mRNAs much longer than the…
A: mRNAs are single-stranded RNA molecules that are complementary to one of the DNA strands of a gene.…
Q: 8. Why is it adaptive for a bacterium to not express the genes that encode for that lactose…
A: Bacteria are able to adapt to their environment by regulating the expression of genes that encode…
Q: Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent…
A: According to bartleby expert guideline we are allowed to answer only one question. Kindly repost the…
Q: 2. What is attenuation and what is its significance in prokaryotic gene regulation? Explain…
A: Gene expression is defined as a process which is used by cells to convert the instructions coded in…
Q: the two factors that bind directly to the DNA at specific sequences are TFID and TFIIB, in genreal…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: 1. What are the main elements of the lac operon and their functions?
A: NOTE- Since you have posted multiple questions So we will be solving the first question for you. As…
Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…
A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…
Q: 18. While studying a human patient with hemophilia, you have discovered that the second exon of the…
A: Transposable elements also are known as jumping genes. These are those DNA sequences that can change…
Q: 14. a. What is the role of insulators? b. What would happen if there were no boundary elements for…
A: 14 . what is the role of insulators? Insulators are the segments of DNA that functions as a…
Q: Consider the experiment conducted by Deng and Roberts to investigate the role of BRE’s in activator…
A: Transcription is a process that leads to the synthesis of mRNA. It is the first half of the central…
Q: 5. During eukaryotic transcription, the molecule that is formed is a. complementary to both strands…
A: the molecule that is formed during eukaryotic transcription is RNA the molecule will be…
Q: 3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?
A: DNA or Deoxyribonucleic acid is the genetic material found in all living organisms. DNA is a double…
Q: If a mutation occurs in a coding region a. it will cause a change or changes in the normal…
A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…
Q: 1- How does the sigma factor control whether it can start transcription together to give way to RNA…
A: Transcription is the process where one strand of DNA is transcribed into RNA is known as antisense…
Q: How might the regulation of the lac operon change if a point mutation occurred that blocks the…
A: Lac Operon consists of structural (z y and a) , regulatory (I), promoter and operator genes in the…
Q: In negative control systems, which of the following would cause transcription to proceed? A)…
A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…
Q: 2. Which one of the following statements is TRUE of bacterial transcription? A. It produces pre-mRNA…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 3. What is meant by the term histone code? With regard to gene regulation, what is the proposed role…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: 6. Which of the following is NOT a similarity between replication and transcription? A) Both…
A: The process of DNA replication is used to replicate genetic information to create two copies of the…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: In the given diagram of splice donor site and acceptor site: - Splicing take place when a group of…
Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…
A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…
Q: 2. How is RNA termination different in prokaryotes vs eukaryotes? Include an explanation of cis vs.…
A: The process of creating a copy of RNA (ribonucleic acid) of a gene sequence can be referred to as…
Q: . In DNA amplification, using the Taq polymerase, what is the maximum number of amplification…
A:
Q: shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: A gene is a stretch of nucleotides present in the DNA. DNA or deoxyribonucleic acid is a polymer of…
Q: 1. What happens during transcription? Possible sentence frame: Transcription is the process in which…
A: Need to fill the blanks related to transcription process.
Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…
A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…
Q: 1. State true or false, giving a brief justification: a. An enhancer is a type of regulatory…
A:
Q: 4. Compare the control of gene regulation in eukaryotes and prokaryotes in terms of: a.…
A: Note: as per the guidelines, we are authorized to answer one question at a time. Please post the…
Step by step
Solved in 3 steps
- 1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is demonstration and define each component? Where is the CAMP-CRP binding site? Where is the RNA polymerase binding site of the promoter? What is the position of the Transcription start site? Promoter I gene Z gene CAMP-CRP binding site RNA Polymerase binding site Operator MRNA DNA sequence -100-90 一B0 -70 -60 -50一40 -30 -20 -10 +1 +10 十20 小30 +40) MetN -Thr - Met1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?
- 5. The following DNA nucleotides are found near the end of a bacterial transcription unit. 3-AGCATACAGCAGACCGTTGGTCTGAAAAAAAAGCATACA-5' Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form. a. b. Suppose that the string of A nucleotides following the inverted repeat in a rho-independent terminator were deleted but that the inverted repeat was left intact. How will this deletion affect termination? What will happen when RNA polymerase reaches this region?a. The original constitutive operator mutations in thelac operon were all base changes in o1. Why doyou think mutations in o2 or o3 were not isolated inthese screens?b. Explain how a mutagen that causes small insertions could produce an ocmutation.c. Would a strain with one of the ocmutations described in part (b) and also a lacIS mutation be ableto make β-galactosidase either in the presence orabsence of inducer? Explain5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
- 5. As you know, the lac promoter is a poor intrinsic promoter: it is transcribed efficiently only when CAP-CAMP is bound nearby. Imagine that a culture of E. coli cells is mutagenized and spread on an agar plate containing IPTG, glucose, and X-Gal. Most of the resulting colonies are white but a few are blue. [IPTG is a lactose analog that binds to and inactivates the lac repressor; unlike lactose, IPTG does not require Lac Permease (LacY) to enter the cell. X-gal is a substrate of B-galactosidase that yields a blue product when cleaved by the enzyme; X-gal does not bind to the lac repressor. For the purpose of this problem, assume that anything less than maximal induction of B-galactosidase results in a white colony. (i) Why was it expected that most of the colonies would be white? (ii) Describe two different mutations mapping within protein-coding DNA that can account for the blue colonies. The two mutations should map in different genes and need not map to the lac operon. Name the…1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?6. By incubating cells with an inhibitor of TFIIH helicase activity. Which step in the transcript would be affected and why? 7. A cell has a mutation that inactivates TAF1 at temperatures greater than 37oC. What will happen in that cell at temperatures greater than 37 oC in class II promoters without TATA box? Why?
- A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT 1.The mutation would move the promoter away from consensus and reduce the level of transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would bind the promoter to the consensus and produce normal levels of transcription 4.The mutation would inhibit the promoter thereby inhibiting transcription12. You want to determine the location of the promoter and operator for an operon. To do so, you create the following deletions and assay their phenotype. The thin lines indicate the deleted region. expression d1 inducible inducible d2 d3 constitutive d4 none d5 none d6 inducible Which of the following can you conclude from this data? a. Part of the promoter is within deletion 1 b. Part of the operator is within deletion 3 c. The promoter and the operator are very close to each other d. Both b and c e. Both a and b1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?