3. Using the double stranded bacterial sequence provided below: ( - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and drawa vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATTGCATAAAGTCGAGCATTATACGGCATTAGGATGGC 3' 3' СCGTAACGTATTTCAGСТCGTAATАTGCCGTAATCСТАССG 5'

Q: The mu receptor is directly activated by: O morphine O methamphetamine O nicotine O LSD

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Question 32 Which of the following is an accurate comparison of Alzheimer and Parkinson diseases? O…

A: Alzheimer's disease is a progressive and irreversible neurodegenerative disorder that primarily…

Q: na synapse: O The pre-synaptic cell is always a neuron The post-synaptic cell is always a neuron…

A: A presynaptic cell is a cell that produces action potential and transmutes it to the postsynaptic…

Q: Question 36 A CD8 cell is associated with which of the following: displaying antigens that are only…

A: CD8  means a cluster of differentiation 8 is a transmembrane glycoprotein that fulfils as a…

Q: Creatine kinase is not affected by oxygen debt O True False

A: Creatine kinase is considered as a marker enzyme, which is present in the heart, muscle, brain, and…

Q: schizophrenia

A: People having schizophrenia exhibit two types of symptoms Positive symptoms and Negative symptoms.…

Q: Question 30 Repolarization corresponds with sodium channels opened O both sodium and potassium…

A: Neurons are the basic structural and functional unit of nervous system and are conductile cells. A…

Q: One difference between nervous and endocrine control is that: Neural control is only on nearby…

A: Nervous system and the endocrine system are the two systems in the body responsible for the…

Q: QUESTION 22 Which of these statements is false? O Physical activity increases the risk of adverse…

A: One of the reasons for the rapid rise in obesity in adults and children is the inexpensive…

Q: example of chemical restraint

A: A chemical restraint is a form of medical restraint in which a drug is used to restrict the freedom…

Q: T/F question The extra cellular matrix of bone is composed of calcium. Blood clotting is produced…

A: Animals are multicellular organisms made of various tissues such as nervous, muscular, epithelial,…

Q: D Question 16 The part of a neuron that conducts impulses away from its cell body is called a(n. O…

A: The structural and functional units of the nervous system which are capable of sending and receiving…

Q: Question 29 Which of the following does NOT describe the autonomic nervous system? O It controls…

A: Nervous system is calssified in the following manner:

Q: In a scientific experiment, the control group: is needed to avoid confusion. is needed so your…

A: in a scientific experiment, the control group is used for comparison with the experimental group.

Q: QUESTION 21 Negative feedback O initiates compensatory, biological responses from sensory receptors…

A: Negative feedback is a self-regulatory system in which it reduces the output for stabilizing the…

Q: Which of these is a form of a signal? O Chemical O Light O Stretch O Temperature

A: Cell signalling processes help in the changes in cell metabolism.

Q: The ability to maintain a constant and optimal internal environment regardless of the external…

A: Maintaining a balanced internal environment is important as enzymes and process happen at a specific…

Q: Which of the statements below best describes the ways that "plaques and tangles" affect brain cells…

A: Alzheimer's disease is a type of brain disorder. The disease slowly destroys memory and thinking…

Q: The cell is the smallest unit capable of maintaining all life processes. Which of the following is…

A: Life processes are the functions performed by living beings.

Q: QUESTION 13 Which of the following are not criteria for a substance to be detined as a…

A: Note: We’ll answer the first question since the exact one wasn’t specified. Please submit a new…

Q: QUESTION 10 Why are the effects of the sympathetic nervous system so much more long lasting than…

A: The sympathetic and parasympathetic nervous systems are part of the autonomic nervous system, which…

Q: Question 21 Which of the following correctly describes Summation ? O is the release of…

A: Summation means integrating or adding the impulses together. It may occur when several electrical…

Q: The levels of "moral reasoning" refer to how many "points of view" are acknowledged or considered…

A: Moral reasoning involves the cognitive process of evaluating ethical issues and making decisions…

Q: What are your views on the two sides of the debate over whetheremergent properties exist? Explain…

A: An emergent property is considered as a property that a collection or complex system has but which…

Q: QUESTION 49 Which of the following is not an appropriate strategy to prevent low back pain O a. When…

A: When lifting an object (assuming a heavy one), it should be kept close to the body so as to reduce…

Q: In this phase, ALL voltage-gated Na+ channels are in the process of re-setting and cannot be opened…

A: An abrupt, quick, temporary, and spreading shift in the resting membrane potential is classified as…

Q: Julian likes to ride his bike every day. Determine the effect of exercise on his basal metabolic…

A: Basal metabolic rate is the energy consumed by the body to perform its essential functions at rest.…

Q: Which of these is a characteristic of epithelial tissue? It usually has rich blood supplies It has…

A: The epithelial tissues are the ones that are present all over the body as a lining for cavities,…

Q: Question 11 Which of the following is a FALSE statement about estrogen? O Excess exposure to…

A: Introduction:- Estrogen is a hormone which is responsible for female secondary sexual characters in…

Q: Which of the following is true of nerve impulse conduction? O Saltatory conduction occurs on…

A: Introduction A nerve fiber is a long and a slender projection of the neuron. It conducts the…

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.