-35 sequence -10 sequence +1 Transcribed lac operon TTTACA N7 TATGTT NG A lacl GCGCAA N7 CATGAT N, Al trp operon TTGACA N7 TTAACT N, A rrnX TTGTCT N16 TAATAT N7 Al TTGATA N46 TATAAT N, A recA lexA TTCCAA Ny7 TATACT NG A TRNA" TITACA N16 TATGAT N, Al Consensus TTGACA TATAAT sequence
Q: In the lac operon system, do the inducers act at the transcription or translation level? Explain why…
A: The lactose operon (lac operon) consists of a regulatory gene (i-gene) and three structural genes -…
Q: Lactose permease is encoded by the lacY gene of the lac operon.Suppose a mutation occurred at codon…
A: I believe this is nothing but missense mutation.
Q: Predict a possible phenotype from the following mutations in the Lac Operon: a deletion in…
A: Lac operon was discovered by Jacob and Monod in Escherichia coli. They found that this bacteria…
Q: All of the following statements about the repressor of the lac operon of E. coli are true EXCEPT…
A: The lac operon is a clustered group of related genes that are transcribed as a single unit. These…
Q: The diagram below represents a hypothetical operon in the bacterium E. coli. The operon consists of…
A: Operon Operon is a place within the DNA which have several gene and all these genes are controlled…
Q: What would happen if the operator sequence of the lac operon contained a mutation that prevented the…
A: The Structure Of lac operon --Genes present in the lac operon specify proteins which help in the…
Q: The lac operon regulates expression of genes required for the breakdown of lactose. Use the…
A: The correct answers are 1- RNA polymerase can bind tightly to the lac Z promoter and activate a high…
Q: The genes shown are from the lac operon system of E.coli. The symbols a, b and c represent the…
A:
Q: For the given genotypes (associated with the lac operon in E. coli), indicate with a "+" or "-"…
A: The lactose operon is an example of inducible operon in which the presence of lactose is responsible…
Q: The diagram below represents the tryptophan operon with the trp leader MRNA transcript eniarged to…
A: Gene regulation at the level of transcription in bacteria is achieved by the operon model.…
Q: 4a. The diagram below represents (a) the lac operon in the OFF state and (b) lac operon in the ON…
A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…
Q: The trp operon in E. coli encodes enzymes essential for the biosynthesis of tryptophan. In the…
A: trp operon is a repressor operon found in E. coli bacteria, which consists of a group of genes that…
Q: that best fits the phrase below (1-20) Cis-acting B Post-transcriptional modification…
A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…
Q: The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a…
A: 1) Allolactose inhibits the repressor, allowing the RNA polymerase to bind to the promoter and…
Q: Which of the following lac operon genotypes would allow for functional versions of all the…
A: lac operon: - Inducible system - Both positive and negative regulation. - Involved in lactose…
Q: On its chromosome, an E. coli cell has a genotype of lacI− lacZ+ lacY+ lacA+. It has an F′ factor…
A: Lac operon is studied extensively by using mutant strains of E.coli. It is studied under the domain…
Q: The attenuation mechanism that helps block expression of the tryptophan operon requires all of the…
A: In transcriptional attenuation, the expression of genes are negatively regulated by controlling the…
Q: A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several…
A: According to the question, we have to mention the strain which has the highest beta-galactosidase…
Q: A strain of E. coli has the genotypes shown below at the lac operon, where I = regulator gene, P =…
A: Escherichia coli, is a gram negative bacteria thrives in intestine of all animals which are warm…
Q: 5f. Complete the diagrams below to reflect the proteins and any relevant cofactors (e.g. -…
A: The lac operon is an operon, or cluster of genes with one promoter (transcribed as one mRNA). The…
Q: A mutation that inactivates transcription and translation from the regulatory gene of an inducible…
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all…
Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…
A: Introduction :- Inactivating mutations, also known as loss-of-function mutations, cause the gene…
Q: The diagram below represents the tryptophan operon with the trp leader MRNA transcript enlarged to…
A: It explains how gene regulation occurs at the transcriptional level in bacteria. The unit of…
Q: the regulation of the lactose operon in Escherichia coli, by measuring expression of the lacZ gene…
A: lactose operon is a set of gene require for the transportation and metabolism of lactose and is…
Q: Choose the best options, by dragging and dropping the colour coded text boxes below, that fill in…
A: Operon is transcription unit of prokaryotic genome with consist of many contiguous structural genes…
Q: ptoph had a mutation on the repressor, not allowing it to bind with tryptophan. The repressor is…
A: Operons are proteins encoded together as a block that performs specific functions and are involved…
Q: Describe a bacterial operon's structural advantage.
A: *NOTE: Kindly repost for other question. Dear Student as per the guidelines we are supposed to…
Q: Give all possible genotypes of a lac operon that produces, or fails to produce, β-galactosidase and…
A: An operon is defined as a group of genes that have a common promoter and regulator and also…
Q: IPTG Absent IPTG Present B-Galactosidase Permease B- Permease Galactoßsidase + O+ z+ Y+ + IS ot z+…
A: Lac operon is the segment of DNA which consists of regulatory gene (I), promoter gene (P), operator…
Q: A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several…
A: According to the question, we have to mention the strain which has the highest beta-galactosidase…
Q: You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH,…
A: Operon is a set of genes which are responsible for conduction of related functions. it is a feature…
Q: The diagram below represents the tryptophan operon with the trp leader mRNA transcript enlarged to…
A: The trp operon is operated in most bacteria including E. coli which is a repressible operon. This…
Q: The lac operon has 4 genes, I, Z, Y and A. For each scenario, tell me the result of the mutation,…
A: The lac operon is an operon or group of genes with a single promoter. The genes in the operon…
Q: The lac operon regulates expression of genes required for the breakdown of lactose. Use the…
A: The lac operon regulates the expression of genes required for the breakdown of lactose through a…
Q: Trp operon of E. coli is an inducible sytem since it turns on in the presence of tryptophan. In most…
A: DNA codes for proteins, which occur in three stages: replication, transcription, and translation.…
Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase…
A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…
Q: Mutations in the genes of an operon could affect the expression of its genes. For each statement,…
A: Introduction: Mutation can be defined as any change in DNA. This is any heritable and genetic change…
Q: Predict a possible phenotype from the following mutations in the Lac Operon: a deletion in…
A: An operon is a functioning unit of DNA that contains a cluster of genes under the control of a…
Q: Matching type Choices are in the picture 11. regulating elements in the operon 12. ribosome…
A: Transcription is the process by which the information in a strand of DNA is copied into a new…
Q: Give all possible genotypes of a lac operon that produces, or fails to produce, B-galactosidase and…
A: The diagrammatic representation of lac operon is given below: -
Q: Recall that the trp operon has a special leader sequence (trpL) between the operator and the…
A: INTRODUCTION Bacteria like Escherichia coli (a friendly inhabitant of our gut) need amino acids to…
Q: Decide which operon each of the following characteristics applies to. Note: a description may apply…
A: Introduction "In E.coli And Other Bacteria, The Lac Operon Is An Operon Or A Set Of Genes With A…
Q: When referring to attenuation in the regulation of the trp operon it would be safe to say that, when…
A: The trp operon is present in E.coli bacteria and is a group of genes that synthesizes biosynthetic…
Q: To characterize the promoter of the gadA operon you made a series of deletion mutants removing…
A: Gad A gene expression is found in the bacteria. They have operon structure in which regulatory,…
Q: The following represents a eukaryotic operon. a.true b.false DNA Promoter Region -35 Box -10 Box -1…
A: An operon is a functional unit of DNA comprising a collection of genes dominated by a single…
Q: . In an effort to determine the location of an operator sitefor a negatively regulated gene, you…
A: An operator is a genetic sequence which allows proteins responsible for transcription to attach to…
Q: An E. coli cell as the following genotype for the lac operon system: I- OC Z+ / F’ I+. Which term…
A: The presence I+ repressor is dominant to the absence of a repressor I-. Oc mutants:- these are the…
Q: A constitutive mutation in the lac operon may be of several types. [Note that constitutive means…
A: A constitutive mutation in the lac operon may be of several types. Here we have to choose two types…
Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Describe two specific base substitutions you think would inhibit the binding of σ factor. Explain why your base substitutions would have this effect.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13b. Which one of the following a cell mutants will be able to switch at least once? [Select]RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleIG-LA ED What pattern of functional protein synthesis of ß-galactosidase and permease, respectively, would you expect from an I*P*OCZ+Y+ lac operon in the absence of lactose? O ++ O -- O +- O+48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- 11c all three of the classes or types of eukaryotic transcriptional regulators have alpha helical structure. name any two of the three major classes of eukaryotic transcriptional regulators.Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primerAUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letter
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this genepcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG