3.1 The diagram below represents protein synthesis that takes place in a human cell. In the diagram, the first 7 triplets of nitrogenous bases that form part of the gene coding for one chain of the haemoglobin (protein) is represented. DNA template 1 2 3 4 5 6 7 TTT CÁC GTG GAC TGA GGA CTC CTC 11 GAG GAG MRNA 8. 묘 CAC 9 10 GTG CAC CTG ACT CCT GAG GAG 3.1.1 How many of the following are coded for in the DNA template sequence represented in the above diagram: (a) RNA nucleotides (b) Genes (c) Amino acids 3.1.2 Write down the nitrogen base sequence of mRNA triplets labelled 8–11. 3.1.3 Using the table below, determine the amino acid sequence coded by triplet number 1 to triplet number 4. Anticodons on TRNA CUC GUG Amino acid Glutamate Histidine Proline Leucine Threonine Valine GGA GAC UGA CAC

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: Antibiotic X binds to the 50S ribosomal subunit of 70S ribosomes and blocks normal ribosomal…

A: Introduction Antibiotics, also called antibacterials, are drugs that kill or slow the growth of…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: 2' HO 5' OH-3' -OH-3 |3' M O A represents Group I introns and B represents spliceosome introns O A…

A: Here,the answer is A represents Group II introns and B represents Group I introns. Group I and Group…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: Human Fbh1 helicase is important in the process of DNA replication. When a muta occurs during the…

A: Introduction : 1) DNA replication is the process by which the genetic material is copied within the…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: Draw a labelled diagram depicting the flow of genetic information from DNA to mRNA of a eukaryotic…

A: A fundamental principle that describes how genetic information moves throughout a biological system…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: Zinc finger nuclease is a Gene editing tool:     which uses a site-specific endonucleases…

A: (Since the student have not mention the specific question to answer, only one and first question…

Q: Which of the following is the most likely reason that many ribosomes do not attach to the surface of…

A: A ribosome is an intercellular structure composed of RNA and protein, and it serves as the site of…

Q: The following picture drawing represents co-translation in E. coli. Answer the questions: A. Which…

A: Using the signal recognition particle (SRP), the co-translational route transports secretory…

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

A:

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…

A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: Which of the following is always true of ribosomes? aM I CORRECT?

A: Ribosomes are organelles that are found in both the eukaryotes and prokaryotes. Ribosomes are…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: Which of the following statement about RNA is FALSE? rRNA is critical for protein synthesis as it is…

A: Ribonucleic acid (RNA) is a nucleic acid which has similar features to DNA and is found in all…

Q: You are studying a mammalian mitochondrion gene that has the sequence below. What is the amino acid…

A: To determine the amino acid sequence, we need to translate the mRNA sequence derived from the sense…

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: To determine how many tRNAs will bind to the ribosome to make the protein, we need to consider a few…

Q: In the presence of cephalosphorin, what will be the protein product of the prokaryotic cell gene…

A: A class of β-lactam antibiotics includes Cephalosporin it is derived from the fungus known as…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…

A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…

Q: Match the following with what organelle (one per blank) it is designated to go (letter can be used…

A: According to the question, we have to make a match the following with what organelle. So, let us…

Q: 1 Foundations Cell Molec The first 17 amino acyl residues in human preproinsulin are…

A: Colinearity simply refers to the relationship between the length of a DNA sequence in a gene and the…

Q: Identify the following mutations and describe what the possible effect on the protein will be. (4)…

A: Mutation in general refers to the change in one or more gene. Some are negligible while others can…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…