Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA AGG GCA CGA GCC CGC GCG CGG GAC AAC UGC GAA CAA GGG CAC AUCC CUG AAA UUA UUG CUA AUA CUC AGC AGU CCA ÜCA ACA CCC UCC ACC UUC CCG UCG ACG GGA GGC GUA GUC UAC GUG UAA UAG UGA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG ÚÚÛ CCU ÚČU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser Thr Trp Tyr Val stop A R D G IL K Y V

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: (iii) Based on the double-stranded DNA sequence of terminator, draw the structure of hairpin loop…

A: Hairpin loop structure It is the secondary structure of mRNA where the complementary base pairing…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: The piece of RNA below includes the region that codes for the binding site for the initiator tRNA…

A: Translation is a fundamental process in molecular biology that converts the genetic information…

Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…

A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: b) Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts…

A: The mRNA is produced from the templates stand of DNA by the transcription process and polypeptide…

Q: Use the numbers below to indicate the correct order of events (from left to right) during the…

A: Hi, Thanks For Your Question.  Answer : Correct Sequence Is 3 4 2 1 5.

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid whereas…

Q: The piece of eukaryotic mRNA below includes the region that codes for the binding site for the…

A: Transfer RNA, or tRNA, plays a crucial role in protein synthesis. It acts as a carrier, delivering…

Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…

A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: quizzes/85114/take WebSTAC Dashboard Workday Help | Wa... Home - Workday b Identify the W Second…

A: DNA complementary-CCG ATC TGA GTA TAG CCC  mRNA- GGC UAG ACU CAU AUC GGG

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA…

A: Template strand runs in the direction 3' 5' end and non template runs in the direction 5' 3'. mRNA…

Q: Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? O a.…

A: Transcription is the second step of central dogma in gene expression involving the synthesis of RNA…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Information of any DNA molecule is present in its sequence of bases on two strands. When cell…

Q: Name each of the processes pictured: 5'

A: protein synthesis ELONGATION PHASE OR PROCESS SPLICING TERMINATION PHASE OR PROCESS

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: What is the function of:  D loop - Anticodon Loop-  TC Loop-  acceptor stem-

A: The term tRNA stands for transfer RNA. tRNAs are small, generally having less than 100 nucleotides.…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…

A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at…

A: Transcription proceeds until the main enzyme RNA polymerase encounters a termination sequence that…

Q: (3) If a DNA sequence is 5' TCC GGT CAT 3' what are the RNA and protein sequences that can be made…

A: Chargaff rule:The rule that in DNA there is always equality in quantity between the bases A and T…

Q: Which of the following types of RNA carries the genetic information from DNA in the nucleus to the…

A: Since there are multiple questions in this particular question, I will answer the first one for you.…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.