Analyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to indicate where each amino acid is located (cytoplasm, membrane, periplasm). kDa55 Cysless352010F16C|||E39C||||+11L860|||[]+| | ||||11+−1++G125C++++111+1+++1++++M18C+1++- ++1++P+U|||+V51CY96CT+++1+F139C| | |11+1++++1+1+++1|+1+M36C| | |+11K72C|D106C| | |+ MTSES- NEM+++mPEG5K-- + +R143C||||+P| | +←U+++P+U+ MTSES- NEM+ MPEG5K+P←U+MTSESNEM+mPEG5K+P+ MTSES- NEM+ + + MPEG5K+U

SCAM (Substituted Cysteine Accessibility Method) is an analytical technique which is used to study…

Answered: Analyse and interpret the SCAM data in…

Analyse and interpret the SCAM data in Fig. 1, and make a table (remember to include a legend) to indicate where each amino acid is located (cytoplasm, membrane, periplasm).

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The following data describe the catalysis of cleavage of peptide bonds in small peptides by the enzyme UTSASE (the arrow indicates the peptide bond cleaved in each case). Substrate Km(mM) kcat(s) PAPALG 4.0 26 РАPАLA 1.5 37 РАРАLF 0.64 18 Based on the above data shown for UTSAse what features of amino acid sequence dictate the specificity of the proteolytic cleavage? A. Large hydrophilic R-groups B. Large hydrophobic R-groups C. Neutral R-groups D. Small hydrophilic R-groups E. Large hydrophobic R-groups F. Negatively charged R-groups G. Positively charged R-groups
The mass of mRNA that has copied a segment of DNA is 36,000 units, the mRNA is placed in the ribosome and represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the amino acid is 110 and the mass of the nucleotide is 300.
Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
Reverse translate the sequence of insulin pasted below:MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCNUse the webserver listed here:https://www.ebi.ac.uk/Tools/st/emboss_backtranseq/Please optimize the codons for Homo sapiens or Escherichia coli. Are the DNA sequences different?
You gathered your data from Lab 4, and found the following values: Total Activity of lysozyme in HEW: 14 units Total Activity of lysozyme in carb 1: 21 units Total amount of protein in HEW: 70 mg Total amount of protein in Carb 1: 15 mg Calculate the extent of purification of lysozyme in Carb 1. 150% 7 fold 70% 15 fold
Do not use Ai
What method could be used to make an immobilised library of 6 different peptides, all differing by one amino acid? E.g. AMFMDE AAFMDE AMAMDE AMFADE AMFMAE AMFMDA
how would you identify whether or not complete resolution of the three amino acids has been achieved
Consider the sequence shown, determine the complementary RNA and the amino acids
Which of the peptide sequences below best matches the hydropathy plot shown? 1. ILYYAGSREDHSGYLIL 2. RAFLILFMTYFLILFLI 3. LHGDQNRERDGHSQERD 4. LIFLAIFPAGSTSEDRR 5. EQSDTERNQHGALIYLI
Subject: chemistry
The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humans