A small lanthipeptide core is encoded for by the genetic sequence shown below. Using this information, answer the following questions: i. Translate the codon list to provide the primary amino acid sequence. ii. Will the mono - sulfide present in the lanthipeptide be a lanthionine dimer or a methyllanthionine? Explain your reasoning. iii. Assuming that the monosulfide dimer is present in its most commonly occurring natural form, draw the structure of the lanthipeptide including the configuration of all amino acid side chains. AUG-GUA- UCA - GGG-UUC-UGC-UAA

A small lanthipeptide core is encoded for by the genetic sequence shown below. Using this information, answer the following questions: i. Translate the codon list to provide the primary amino acid sequence. ii. Will the mono - sulfide present in the lanthipeptide be a lanthionine dimer or a methyllanthionine? Explain your reasoning. iii. Assuming that the monosulfide dimer is present in its most commonly occurring natural form, draw the structure of the lanthipeptide including the configuration of all amino acid side chains. AUG-GUA- UCA - GGG-UUC-UGC-UAA

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

When the amino acid sequences of insulin isolated from different organisms were determined, differences were noted. For example, alanine was substituted for threonine, serine for glycine, and valine for isoleucine at corresponding positions in the protein. List the single-base changes that could occur in codons of the genetic code to produce these amino acid changes.
Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.
Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids in length. By convention, theamino acids within a polypeptide are numbered from the aminoterminalend to the carboxyl-terminal end. Are the following questionsabout lactose permease true or false?A. Because the sixty-fourth amino acid is glycine and the sixty- eighth amino acid is aspartic acid, the codon for glycine,64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68.B. The mRNA that encodes lactose permease must be greater than1241 nucleotides in length.
Pro-CHEMBIO peptide is a large peptide sequence with three disulfide bonds (indicated by the lines between cysteine residues). CHEMBIO Protease cleaves amide bonds between two basic amino acid residues to give the final peptide that is active in the body. The products of this protease reaction are: 1. Two chains that make up active CHEMBIO peptide, which contain the N- and C-terminus sections of the original Pro-CHEMBIO molecule 2. A separate inactive peptide What if instead of CHEMBIO Protease, this peptide was cleaved by trypsin? Indicate the cleavage locations on the structure below. asap
A peptide with the primary structure Lys-Arg-Pro-Leu-Ile-Asp-Gly-Ala must be synthesized by the methods developed by Merrifield. Calculate the percentage of the peptides synthesized that will be full length and have the correct sequence if the addition of each amino acid residue is 96% efficient. Do the calculation a second time but assume a 99% efficiency for each cycle. full-length peptides with the correct sequence if 96% efficient: full-length peptides with the correct sequence if 99% efficient: % %
A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.
Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)
In pyrimidine nucleosides, the anti conformation predominates. Explain. Do the purine nucleosides have similar interactions?
Many blood clotting proteins undergo a post-translational modification in which specific glutamic acid residues (Glu) in the protein are converted to gamma-carboxyglutamic acid residues (Gla). See reaction scheme below. An example is the blood clotting protein Factor IX, which has 12 Glu in its N-terminus converted to Gla. This modification gives Factor IX the ability to bind calcium and phospholipid membranes. Bacteria do not have the enzyme required to convert Glu to Gla and therefore Factor IX proteins expressed in bacteria would not have the proper modifications. How might you engineer the translational apparatus of a bacterial cell line so that it produces Factor IX with Gla in the appropriate positions. How would you ensure that only the 12 Glu in Factor IX that are normally converted to Gla and not just all Glu (Limit 5-6 senetnces)?
What are the properties of the wild type amino acid, Tyrosine at position 368? Hint: the amino acids are numbered in order starting at the N-terminus.
There is another melanocyte-stimulating hormone called β-melanotropin.Cleavage of β-melanotropin with trypsin produces the following peptidesplus free aspartic acid. WGSPPK DSGPYK MEHFRIf you assume maximum sequence similarity between α-melanotropin andβ-melanotropin, then what must the sequence of the latter be?
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?