3. Despite your chaotic nature, you various types of RNA species (molecules) following their injection into a nucleus of a eukaryotic cell. In the table below, each of the listed RNA species was fluorescently tagged and then individually injected into the nucleus. For each species, indicate where it will localize or migrate, as well as what you expect to observe when the sample is viewed under a fluorescence microscope. RNA species a. pre mRNA b. pre rRNA c. mRNA d. rRNA e. tRNA Localization and/or migration Observations

3. Despite your chaotic nature, you various types of RNA species (molecules) following their injection into a nucleus of a eukaryotic cell. In the table below, each of the listed RNA species was fluorescently tagged and then individually injected into the nucleus. For each species, indicate where it will localize or migrate, as well as what you expect to observe when the sample is viewed under a fluorescence microscope. RNA species a. pre mRNA b. pre rRNA c. mRNA d. rRNA e. tRNA Localization and/or migration Observations

Name: 3. Despite your chaotic nature, you have decided to use fluorescence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 3. Despite your chaotic nature, you have decided to use fluorescence microscopy to monitor and observe the fate ofvarious types of RNA species (molecules) following their injection into a nucleus of a eukaryotic cell. In the tablebelow, each of the

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 3VCQ: Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks...

See similar textbooks

Similar questions

6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.
28.Bacteria X contains the double stranded DNA sequence below. Our task is to design a labelled primer (probe) to detect this sequence. Which sequence below can be used for this task? Identify the single most correct answer below. * indicates a label 5' ATGCTTTTTTTAAACCCCGGGGTTTT 3' 3'TACGAAAAAATTTGGGGCCCCAAAA 5' a) 3' AATTTGGGGC* ( b) 3' ATGCTTTTTT* ( ) c) 5' TTTAAAGGG* 19 ( ) d) 5' ATGCTTTTTT* ) e) a and b () f) a and d 23 g) b and d 29.Ames assay is patented, so 2nd yr microbiology students devised a new assay where wild type GFP (green florescence protein AKA light producing) is used as the target gene, for mutation rate analysis. When compound A is added, even in very low concentrations, all colonies formed end up producing light (produce fluoresce). Therefore, one can conclude that compound A is a strong mutagen. () True False 30.The consensus SD (Shine/Dalgarno sequence) is 5' AGGAGGU. Identify the single most correct answer below. a) The SD sequence 3' AGGAGGU is stronger than…
2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?
- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA.
4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC
1. Draw the sequence of events that lead to kinesin heads moving along a protofilament of a microtubule. Start with the leading head( label #1) bound to the protofilament but not associated with a nucleotide and the lagging head(label #2) loosely associated with the protofilament and bound to ADP Represent the events that occur that lead to head #2 advancing in front of head #1. Your drawing should accurately represent the conformational changes in the neck linker and type of nucleotide bound to kinesin. Label the tubulin dimers ( alpha, beta), neck linkers, coiled coil , and the polarity of the protofilament( plus end , minus end). Use arrows to indicate direction of movement.
3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay attention to the 5' and 3' ends!) 3' GGCTTATACGGGCCAAACGTGCATATTGC 5' a) Gene: Matching mRNA 5' 5' TGAACATGGGCAGGTTGACTCGGATCATG 3' b) Gene: Matching mRNA 5' 3' 3'
1. For each of the items below, give a brief description (indicate function for enzymes) and indicate in which process (replication, transcription, or translation) it is involved with. helicase Description/Funetion catalyzes the unwinding of DNA strands Process involved in replication 11. terminator 12. ribosome 13. amino-acyl RNA site 14. MRNA 15. tRNA 16. rRNA 17. Shine-Dalgarno sequence 18. start codon 19. Okazaki fragments 20. coding strand 21. peptidyl tRNA site
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to mix with genomic DNA that has been denatured by boiling, and the two molecules are allowed to hybridize. The DNA strand is presumed to be the lighter-shaded one on the top. Note that only one strand of DNA is shown. What type of RNA is this? a eukaryotic mRNA b Any type of Eukaryotic RNA c Any bacterial or Eukaryotic mRNA d Any RNA from any species
Classifiation of Llfe A new organism was discovered in a deep sea vent at the bottom of the ocean. The researchers collected the sample and made careful observations of it. The picture at right shows a microscopic image captured at 1000X its actual size. Below are some other observations made: • When DNA was isolated from the cell, it was mixed with an equal portion of histone proteins • There are no visible organelles present inside the cell • The specimen seem to die in the presence of oxygen • Able to live in conditions that mimic deep sea vents without any external food source provided Based on these observations, determine each of the following and provide a clear rationale. A) To which domain would you assign this organism? Why? B) Propose a hypothesis of how they obtain nutrients. Are these most likely autotrophs or heterotrophs? Provide a rationale.
8) Which of the following best describes why it is possible for the bacteria to read the instructions in a human gene and produce a human protein as a result? Bacterial cells and human cells are identical and contain the same organelles Bacterial cells and human cells both use DNA to store their genetic information The genetic code is universal - the same codon codes for the same amino acid in all species The bacterial cell already contains a gene that is very similar to the human growth hormone gene