1a Briefly describe or explain what the term "supercoiling" means in the context of DNA structure. What is the difference between positive and negative supercoiling?

Q: Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).

A: These nucleotides are connected by phosphodiester bonds between the 3' carbon of one sugar molecule…

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: While studying the structure of a small gene that was recently sequenced during the Human Genome…

A: The rule in the case of DNA indicating that there is always equality in quantity between the bases A…

Q: 1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were…

A: To help you better understand the answers above, here are non-technical explanations of each…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: What is the purpose of the ethidum bromide that you add to the gel? Why do you need to be careful…

A: Gel electrophoresis Gel electrophoresis, it is a technique by which one can separate and analyse the…

Q: Why is it important to restore displaced histones to the DNA following transcription? A) to reform…

A: The process of transcribing information from a strand of DNA into a new messenger RNA molecule is…

Q: The two strands of DNA that make up the double helix are held to each other by ... a) hydrogen bonds…

A: DNA is made up of nucleotides which contains three parts: a sugar molecule (deoxyribose), phosphate…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: (a). The DNA supercoiling is the manifestation of a structural strain in the DNA by a twisting of…

Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…

A: DNA sequencing  Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.

Q: (a) At low temperatures, what two enthalpic variables stabilise DNA in a double-helical form? (a) At…

A: Deoxyribonucleic acid is a molecule did up of two polynucleotide chains that coil around each other…

Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…

A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…

Q: Explain the mechanism of trinucleotide repeat expansion.

A: Introduction: A trinucleotide repeat expansion is type of DNA mutation. In which, the trinucleotide…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: describe what is s autonomouslyreplicating sequences?

A: Yeast is eukaryotic, single-celled microorganism classified as members of the fungus kingdom. The…

Q: What is the purpose of the dideoxynucleotide triphosphates in the Sanger sequencing reaction?

A: In 1977, Sanger proposed chain termination method of DNA sequencing. He used ddNTP or…

Q: 37. How is a DNA structure stabilized and packed within the eukaryotic chromosomes? Is DNA…

A: The length of DNA in the nucleus is far greater than the size of the compartment where it is…

Q: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: 9. The hydrogen bonds and ring-stacking interactions that hold a DNA double helix are individually…

A: Nucleic acids are one of the major macromolecules present in every cell. These large molecules are…

Q: Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features:…

A: Introduction: DNA polymerases are the group of enzymes that catalyze the synthesis of DNA strands…

Q: 3a) Both DNA synthesis and RNA synthesis are carried out by polymerases that catalyze the formation…

A: DNA replication occurs in all living organisms and is essential for passing the genetic information…

Q: 18 Fred Sanger developed an effective DNA sequencing technique in 1977. Thepeed at which DNA can be…

A: Fred Sanger developed DNA sequencing technique in 1977.  DNA sequencing is based on the base pairs…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: The single stranded DNA can fold back and base-pair with itself, thus providing both template and…

Q: 2) A few years ago, a graduate student in my lab realized that a DNA construct in which he fused the…

A: The recombinant fusion protein can be constructed using the component proteins and linker. The…

Q: How can we visualize the effect of supercoiling on the structure of DNA? (describe supercoiling)

A: Supercoiling (means the coiling of a coil) represents a coiling of the DNA double helix upon itself.…

Q: 21:41 จ. 8 ก.ค. ... Reading assignment MD. 201 (No. 1-3) - by J.Kaulpiboon 6. Check your…

A: The lane with the longest DNA fragment is Lane 1 as its fragment moved very little from the starting…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.