1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence          5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence         5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…

A: During the translation, the information present in the mRNA sequence results in the formation of…

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: . Code the following mRNA strand into amino acids AUGUGUCGGGACACAUAA

A: Introduction An amino acid is any organic acid that has an alpha carbon atom which is attached to an…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Identify the term being asked by the statement: a. It describes mRNA that results in a single…

A: The RNA is produced from the DNA by the transcription process and the mRNA is used for the protein…

Q: elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit…

A: Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…

A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the…

A:

Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…

A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: I only need letter D and E

A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…

Q: What is the mRNA sequence of this DNA and in which direction will mRNA polymerase travel?

A: Messenger RNA is also known as mRNA is a single-stranded RNA molecule, which is complementary to one…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…

A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…

Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3

A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…

Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…

A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: DNA or deoxyribose nucleic acid is the genetic material for most organisms. It is a polymer of…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…