3. (i) Referring to the genetic code (the codon usage table), what would be the amino acid sequence of the polypeptide encoded by the following mRNA sequence? 5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’ (ii) What would be the effect on translation of the above sequence of a single base (point) mutation which gave rise to an A instead of a U at the twelfth base? (iii) What would be the effect on translation of the sequence in (i) above, if an extra C were inserted between the third and fourth bases, i.e., between the two Gs at position 3 and 4?

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA…

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: 44

A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: Explain the significance of the following statement: The functioning of the aminoacyl-tRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: 7. The large subunit of the ribosome contains the E, P, and A sites. Discuss what occurs at each…

A: Ribosomes are cell organelles involved in the synthesis of proteins, they are present freely in the…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: All of the followings are correct, except ---------------------. A. Continuous capillaries like…

A: Introduction Capillaries are small blood veins that form networks throughout the body's tissues,…

Q: Determine the type of mutations based on the nucleotide change- indel vs substitution- that occurred…

A: The mutation is a random process. The mutation causes change in sequence of nucleotides.

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 1) List 5 factors involved in the process of either initation or elongation of translation

A: Translation is the process by which the genetic code contained within an mRNA is decoded to produce…

Q: hange the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: Table 1 Blood pressure recordings for all positions Body positions Mean systolic BP Mean diastolic…

A: There are Physiologic changes which are associated with aging leads to an increase in systolic blood…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.