1. DNA coding strand: CCC TCA ATC GAG AAA GGT DNA template strand: MRNA: Peptide chain: 2. DNA coding strand: ATG GCC TGG ACT TCA GGT DNA template strand: MRNA: Peptide chain: 3. DNA coding strand: GGG TGA GCT TTC CCG TTA DNA template strand: MRNA: Peptide chain: 4. DNA coding strand: TAC TẤT GCC TTA ACC CAT DNA template strand: mRNA: Peptide chain: 5. DNA coding strand: TÁC ACC GTT ATC GGG CTA DNA template strand: MRNA: Peptide chain:

Q: 6. During penetration of E. coli by a bacteriophage lysozyme is used to allow entry of the…

A: Note:- Sorry, since you have posted multiple questions So we will be solving the first one for you…

Q: 1. A point mutation occured at base 6 in the original DNA, provide the amino acid seuence and the…

A: Any detectable, inheritable qualitative or quantitative changes in genetic material of an organism…

Q: 14. An RNA strand that is complementary to specific regions of mRNA Group of answer choices 1.…

A: Thank you for the question : Answer :- the correct option is option 2 (Antisense RNA) Explanation :-…

Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC

A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…

Q: QUESTION 7 Which sequence is the complement to sequence 5'-AGTTACTAAA-3'? O a. 5'-TCAATGATTT-3'…

A: Ans is... c

Q: 22 years old man is shot in the back. The bullet transects the spinal cord at T-5 and he becomes…

A: Different parts of the nervous system and brain functions for different voluntary and Involuntary…

Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…

A: DNA is double stranded where the two strands are antiparallel and follows complementary base…

Q: The process by which non-viral DNA is brought into a bacterial cell by a phage is referred to as…

A: Bacteria are microscopic organisms that positioned in prokaryote as these are unicellular organisms.…

Q: 16. Why 70% alcohol is used as a disinfectant? Circle all possible explanation. O A. Alcohol…

A: Introduction  Various bacterial strains caused wide range of diseases and are pathologically…

Q: This enzyme or structure does not play a role in formation or resolution of the double Holliday…

A: A double Holliday junction is a structure formed in DNA during homologous recombination. It is made…

Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…

A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…

Q: explain also.

A: PABP (Poly A binding protein) is a RNA binding protein which triggers the binding of eukaryotic…

Q: gpll, gpV and gpX with the rolling cycle replication pattern of M13.

A: DNA Replication : DNA replication is the phenomenon or process in which a duplicate copy of DNA is…

Q: rmine the sequence of the contig. G ATCT ATGA ATGG ATTC CCCT CCTG CTCT CT C CTTT GAAG GATT GCGT GCTC…

A: introduction In graph theory, an -dimensional De Bruijn graph of symbols is a directed graph…

Q: Priming for virus DNA replication can happen by all of the following EXCEPT: O a. Primase adding a…

A: Primer is a short nucleic acid, that is a starting point for DNA synthesis.

Q: OLD STRAND NEW OF DNA REPLICATION TCG ATT ACT 1 ACT AGT ACT 4 AGG ACC TAC CTG TAG 7 AGG STRAND OF…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: sequence below use sequence and encountered a point mutation:…

A: Transcription  It is the process of transcribing the sequence from the DNA strand into the mRNA…

Q: The DNA strand whose %T is 50% DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C…

A: According to Chargaff's rule, there is always equality in quantity between the bases A and T and…

Q: Given the DNA of the three organisms, determine the mRNA, IRNA, and the amino acids that correspond…

A: There are 64 possible codon for four nucleotides out of 64 codon 61 code for Amino acids and 3 do…

Q: Match the terms with their most suitable description. ___ methanogen           a. component of…

A: The cell is the basic structural and functional unit of our body. It carries out many functions in…

Q: Contrast early and late-onset Alzheimer disease. What are three genes associated with the…

A: It is a neurodegenerative disease that occurs in old people where there is memory loss (dementia)…

Q: sequence of amino acids.

A: The central dogma of molecular biology is the concept which explains the flow of genetic…

Q: The process of transferring DNA from one bacterium to another through a bacteriophage is called O…

A: Bacteriophage are obligate intracellular viruses that infect bacteria. Phage is surrounded by a…

Q: -35 consensus sequence: -10 consensus sequence (Pribnow box): Shine-Delgarno sequence in the…

A: At 10 sequences and 35 nucleotide sequences upstream from the coding sequence and Shine Dalgarno…

Q: The origin is the site on the DNA: is ONLY where transcription begins is ONLY where translation…

A: Origin is the site seen on the DNA sequence which initiates the process of replication. This is…

Q: . Replicate, Transcribe, and Translate: 3’ T A C T A A T T T T C C C G G A T T 5’ 5’ A T G A T T A A…

A: A double-stranded DNA strand runs in two opposite directions. One strand runs in 5' to 3' and the…

Q: v A 1. Sar1 GEF v B 2. protein with an N-SIG (only) in a class B yeast sec mutant 3. cis-Golgi…

A: Golgi apparatus are membrane bound organelles present in eukaryotic cells. It functions in packaging…

Q: 4- Write the following DNA sequence in the language of RNA. 5'-ACGCGGAGTACTCCGCGGAACCTAT-3' .

A: Both both RNA ( ribonucleic acid)  and DNA ( Deoxyribonucleic Acid) are nucleic acids that are found…

Q: 2. DNA Template:  TTA - CAT - CAT - ATC - GAT - GAC  mrNA: tRNA: Amino acid sequence:

A: All cells divide to give rise to new cells at some specific stage of their life or throughout. The…

Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…

A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…

Q: 4. Which of the following mutations would be silent, missense, nonsense, or frameshift? The original…

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur due to…

Q: The process in which recipient bacterial cells acquire genes from cell-to-cell contact with other…

A: Transfer of genes in prokaryotes occurs through horizontal gene transfer mechanisms like…

Q: 1. Use the prokaryotic gene DNA sequence below to answer the following questions: 1 11 21 31…

A: The DNA sequence is replicated to produce daughter DNA which is the same as the parent DNA. Further,…

Q: Which of the following uses a virus to transfer DNA between two different cells? Conjugation…

A: Bacteria are prokaryotes. They have extra chromosomal contents called as plasmid. This is used as…

Q: .Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A: Mutation It is defined as the change in the sequence of DNA. These are caused from mistakes in the…

Q: 1. What are the similarities and differences between Bacterial Chromosomes & Eukaryotic Chromosomes?…

A: As per bartleby guidelines only 3 questions can be answered. Please post remaining questions…

Q: Below steps in the lytic cycle of bacteriophage have been arranged in random order and with lette…

A: Ans. The lytic cycle is one of two cycles of virus or bacteriophage reproduction; the second cycle…

Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…

A: Muscular dystrophy  It is a genetic disorder, in this disease the muscle of the individual weakens.…

Q: 8) In fungi, the 165 FRNA ITS2 region is widely used as a bar code for identification purposes (true…

A: Any member of the group of eukaryotic organisms that includes microorganisms such as yeasts and…

Q: Instructions: Answer the questions shown below on the following answer sheet.…

A: DNA is a genetic material which carries some hereditary information in form of genes which is…

Q: Identify a FALSE statement from the following, if any Group of answer choices both fimbriae and…

A: Bacteria are the most simplest and primitive prokaryotes lacking a nucleus in the cell. They consist…

Q: An organisms Niche can be defined as A. It's physical and biological requirements B. the range they…

A: Introduction :- A niche is the fit of a species to a certain environmental situation in ecology. It…

Q: 20. The image above reveals two bacterial cells in the process of A. cell lysis B. transduction C.…

A: In the image given for MCQ (20), the two bacterial cells are under the process of "Conjugation".…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes…

A: The mRNA at the third position is AUG and it is called Initiation codon.

Q: Lysogenic bacteriophages can Become dormant in host cells Transfer new genes to bacteria Integrate…

A: Answer is (E) All of the above Lysogenic bacteriophage can become dormant in host cells transfer…

Q: Which process aids in the attachment of a bacteriophage to its host cell? random collisions,…

A: Bacteriophage is a virus that attacks and  uses bacterias to reproduce and complete its life cycle.…

Q: 1. The Evolution of Fur Color in Antarctica (Transcribe & Translate the Mutant) Brown-Fur Bear in…

A: Answer: MUTATION = It is the change occured in the nucleotide sequence either , addition or deletion…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.