Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine

Q: 5. The image below is a mRNA message. Please draw a ribosome translating the message below. Draw the…

A: Solution: the required labelled image is provided in the image attached below:

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: The length of a protein is determined by the number of amino acids it is made up of. In this case,…

Q: what molecular complex serves as a recognition. factor for premature stop codons? exon-junction…

A: Codons are the combinations of three nucleotides and specify the amino acids during the process of…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

A:

Q: Capping of eukaryotic mRNA occurs at the 5' end O occurs at the 3' end O occurs at both ends O…

A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: A DNA sequence is transcribed into an RNA molecule with the help of the enzyme RNA polymerase is…

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: Please find the mRNA strand: Amino acid sequence How does the amino acid sequence from the base…

A: BASIC INFORMATION    TRANSLATION  It is the process in which protein is which formed from the…

Q: Choose from the following: 5'cap, exon, a site, promoter, p site, intron, AAUAAA, start condon 1.…

A: Transcription is the process by which genetic information encoded in DNA is used to synthesize a…

Q: Which of these is unique to how the MRNA is structured compared to pre-MRNA O MRNA combines with…

A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: mRNA…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of  DNA, it is known as transcription. Transcription is…

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: In genomics, transcription is the process of creating an RNA copy of a gene's DNA sequence. This…

Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…

A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: Here is the complete mRNA sequence from a bacterial cell: 5'…

A: In protein synthesis, the process of translation converts the sequence of the mRNA (messenger RNA)…

Q: The arrow in the diagram below indicates the direction of transcription. A BTTT…

A: Q. Ans:- The given image shows the process of transcription. Transcription:- Transcription is a…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Transcribe the gene to the mRNA sequence and label start and stop codon. Translate mRNA to protein…

A: Gene expression is the process of converting the instructions encoded in a gene's DNA sequence into…

Q: If you have an mRNA sequnece below that looks like : 5' cap,  Cytidine, CCUCUUUUCC,  gene,  AAAAA…

A: Messenger RNA or mRNA is a single stranded RNA synthesized from a DNA template by a process called…

Q: he of a hucleić áčid is the nitrogen bases. True

A: Nucleic acid is a biomolecule that was composed of a nitrogenous base, a pentose sugar, and a…

Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…

A: All the information is present in the DNA that will be required for the synthesis of proteins. In…

Q: Match the molecule with its correct description

A: mRNA - Carries a copy of the genetic "message". tRNA  -   Has anticodons Aminoacyl tRNA synthetase -…

Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…

A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…

Q: Cells can control or regulate the amount of a particular proteins that is produced by using small…

A: RNAi (ribonucleic acid interference) is also known as gene silencing. It is a biological process…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: Frameshift Insertion Mutation – Can be one or more nucleotides. 5’   ATG   GGG    AAA    GAT    TAT…

A: Any heritable change in an individual's genetic makeup is referred to as a mutation. It's when a…

Q: Which of the following types of RNA carries the genetic information from DNA in the nucleus to the…

A: Since there are multiple questions in this particular question, I will answer the first one for you.…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: TRNA is synthesized during transcription. OTrue O False Next Page Back

A: Tranfer RNA is a type of RNA molecule that help decode a messanger RNA and specifies an amino acid…

Q: A TRNA molecule is an ncRNA that has which function(s)? Check All That Apply guide template for…

A: Ribonucleic acid is an important biological macromolecule that is generally present in all…