Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA' 1. What is the name of this molecule? 3TACTCCCGCTCGCCGCGGGTGCAAAATĊCCACT³ 2. What cellular process is being shown by the arow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA MRNA 4. RNA should be in as to 3'rection. Rased on this Information which DNA strand will be your template strand to make the mANA 5. What ceflular process is being shown by the arrow (mRNA to amino acids?) Where in the cell does this process take place? Amino acids Use the codon chart to detemmine the correct amino acids. (you may abbreviate) How many RNA bases make up a odon? MRNA Codon Chart What is the pose of a on? UCAO Alanine GU Tyrosine C Stop GU AC Valine Cysteine Stop G A G Tryptophan Arginine AG U č Leucine Serine C Lysine UG ACU GACU Proline Asparagine Glycine Aspartic acid Leucine Serine 110345 Threonine Histidine Methionine Isoleucine
Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA' 1. What is the name of this molecule? 3TACTCCCGCTCGCCGCGGGTGCAAAATĊCCACT³ 2. What cellular process is being shown by the arow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA MRNA 4. RNA should be in as to 3'rection. Rased on this Information which DNA strand will be your template strand to make the mANA 5. What ceflular process is being shown by the arrow (mRNA to amino acids?) Where in the cell does this process take place? Amino acids Use the codon chart to detemmine the correct amino acids. (you may abbreviate) How many RNA bases make up a odon? MRNA Codon Chart What is the pose of a on? UCAO Alanine GU Tyrosine C Stop GU AC Valine Cysteine Stop G A G Tryptophan Arginine AG U č Leucine Serine C Lysine UG ACU GACU Proline Asparagine Glycine Aspartic acid Leucine Serine 110345 Threonine Histidine Methionine Isoleucine
Biology 2e
2nd Edition
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark
Chapter4: Cell Structure
Section: Chapter Questions
Problem 17RQ: Which of the following sequences correctly lists in order the steps involved in the incorporation of...
Related questions
Concept explainers
Oogenesis
The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase.
Cell Division
Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons:
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 6 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Recommended textbooks for you
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Biology: The Unity and Diversity of Life (MindTap…
Biology
ISBN:
9781337408332
Author:
Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:
Cengage Learning