1. Biochemist Liza was asked to perform polyacrylamide gel electrophoresis (PAGE). However, she encountered the ff. problems (a to d) while working in the lab. Identify possible reasons for the error and the implications in the results if she were to proceed with the experiment despite the problem/s encountered. Possible reason for the Implications in the Experimental step said observations experiment a) The gel solution was placed in the cast but did not polymerize. b) Proteins were loaded in the gel but there were no bands upon staining with Coomassie blue while clear bands were seen for standards run alongside the sample. c) The purity of a protein sample is being confirmed 3 bands of different molecular weights were observed after the native-PAGE run d) A protein sample that is expected to have 2 subunits with slight differences in MW was run on SDS-PAGE. After the run only one band was observed.

1. Biochemist Liza was asked to perform polyacrylamide gel electrophoresis (PAGE). However, she encountered the ff. problems (a to d) while working in the lab. Identify possible reasons for the error and the implications in the results if she were to proceed with the experiment despite the problem/s encountered. Possible reason for the Implications in the Experimental step said observations experiment a) The gel solution was placed in the cast but did not polymerize. b) Proteins were loaded in the gel but there were no bands upon staining with Coomassie blue while clear bands were seen for standards run alongside the sample. c) The purity of a protein sample is being confirmed 3 bands of different molecular weights were observed after the native-PAGE run d) A protein sample that is expected to have 2 subunits with slight differences in MW was run on SDS-PAGE. After the run only one band was observed.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Is the inhibitor competitive uncompetitive or non competitive? Why?
Only need help with parts a,b and c please, and thank you!
Please asap
DNA Extraction Using household materials Wash the fruit. Place the fruit (e.g. banana) in a zip lock plastic bag and crush it with your fist. Add the one half teaspoon of salt and one tablespoon of dishwashing liquid to the mashed fruit mixture in the bag, zip it up and squeeze it in your hands for 1 minute. Place the strainer over the small glass. Pour the mixture into the strainer. Filter the mixture into the glass. Slowly pour ice cold rubbing alcohol into the glass, until it is about half full. Let it stand until the alcohol will form a separate layer on top of the fruit filtrate. Keep the glass still at eye level; do not shake it. Watch what happens. DNA will begin to appear where t 9. Carefully Scoop out the DNA with the straightened end of the paper clip. Touch the DNA. he alcohol and filtrate layer meet A. In step 4, isopropyl alcohol is used to precipitate out the DNA because it is not soluble. What does this mean? B. What role did the alcohol, detergent and salt play?…
Please choose the correct answer. Thank you!
DNA WORKSHEET Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.
DNA Replication, Sequencing, and Recombination - PowerPoint Karla Henthorn KH Animations Slide Show Review View Help O Tell me what you want to do A A E. s et Direction- Align Text Shape Fill O Find US abs AV- Aa - ay. A- Stiape Outine- ab Replace- ne Arrange Quick Styles Convert to SmartArt Shape Effects A Se Font Paragraph Drawing 6 5 4 1 3 Ec 2 1 2 3 H4 Kim ACTIVITY Consider the following DNA molecule: ACG GTACACTTA C G A A Henthorn, ic T GCCAT GT GA ATG CT T Rc 1) Draw the 2 strands after they have "unzipped". 2) Follow the rules for pairing and fill in the new strands with the correct nitrogenous bases. Write these new strands in a different color of ink. = Notes Comments 可 DO DELL
DNA profiling
Need help
Need help, please. Please refer to the images attached. The questions are in the second image attached asking for basepair lengths. The first image is just for information.