Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG" 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.

Q: For a DNA sequence 5'-CTAAGCCGGAT-3', what is the complementary DNA sequence?   Question 6…

A: DNA or Deoxyribonucleic acid serves as the hereditary material of almost all living entities (some…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: need to understand how to know which is 5' overhand and which is 3' overhang

A: EcoRI is a restriction enzyme-producing sticky ends. It identifies the specific sequence GAATTC on…

Q: explain why you chose that answer. Your explanation should discuss the replication of DNA in…

A: DNA replication is the process by which a double-stranded DNA particle is duplicated to deliver two…

Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.

A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: DNA replication Using the labels below, assign them to the appropriate parts of the diagram.

A:

Q: Part C: The Big Picture – In this part, you will use answer questions. 1. When you were creating the…

A: DNA replication is a process where DNA makes a copy of itself to produce two identical DNA…

Q: Determine the characteristics of this piece of double-stranded DNA.   GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…

A: DNA REPLICATION :-  It is the process by which DNA makes a copy of itself during cell division.  The…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: In DNA replication, the nucleotides used during PCR __________ compared to the nucleotides used…

A: Polymerase chain reaction PCR, which is a laboratory technique used to amplify a specific region of…

Q: Please use the below DNAs and complete 4 steps question. Thanks1

A: Replication : It is the biological process of producing two identical replicas of DNA from one…

Q: What determines the code, or information, of a DNA molecule? O 1. the shape (structure) of the…

A: Deoxyribonucleic acid (DNA) is a polymer comprises of two polynucleotide chains which coil around…

Q: Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6.…

A: Coronaviruses are a bunch of viruses that cause diseases like Severe Acute Respiratory Syndrome…

Q: Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so…

A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: There are few important points which could kept in mind these are as follows: As protein synthesis…

Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…

A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Q: 8. Cytosine makes up 38% of the nocleotides in a sample of DNA from an organism. Approximately, what…

A: DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid) are both types of nucleic acids that play…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: Shown is a sequencing gel. Read the sequence off the gel and determine the first 4 nucleotides (or…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions for the…

Q: The two strands of DNA are held together by. bonds, but can be denatured by and The nucleotides are…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2.…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.