Signment Required information second RNA primer leading strand First Okazaki fragment 5' 3' Okazaki fragment The leading strand elongates, and a second Okazaki fragment is made. A The leading strand continues to elongate. A third Okazaki fragment is made, and the first and second are connected together. Q Search 3 5' 5' 3' S < Prev 89 10 of 16 Next > chp

Signment Required information second RNA primer leading strand First Okazaki fragment 5' 3' Okazaki fragment The leading strand elongates, and a second Okazaki fragment is made. A The leading strand continues to elongate. A third Okazaki fragment is made, and the first and second are connected together. Q Search 3 5' 5' 3' S < Prev 89 10 of 16 Next > chp

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

דוידודוודי www.www. The above image shows DNA during replication. The new DNA strand build using the top strand as the template would be considered ( Select ] v strand, whereas the new DNA strand build using the bottom strand as the template would be considered ( Select) strand. The lagging strand is synthesized discontinuously and is made up of small fragments called [Select ] v fragments. These fragments contain RNA primers synthesized by [ Select ) ( Select) replaces RNA in the primers with DNA and [ Select ] v glues the fragments together to form a continuous strand. in
Give only typing answer with explanation and conclusion You are studying a strain of bacteria that carries a temperature-sensitive mutation in one of the genes required for DNA replication. The bacteria grow normally at the lower temperature, but when the temperature is raised they die. When you analyze the remains of the bacterial cells grown at the higher temperature you find evidence of partly replicated DNA. When the strands of this DNA are separated by heating, numerous single-stranded DNA molecules around 1000 nucleotides long are found. Which of the proteins listed below are most likely to be impaired in these mutant bacteria and why?: Primase, Helicase, or DNA Polymerase?
expalin Yeast centromeric DNA sequences
In the boxes below, complete the Original DNA, DNA Copy and/or RNA
Describe the process of DNA replication as if explaining it to a fellow classmate. Imagine there is an unlabelled diagram in front of you to guide your explanation. (Try to include as many relevant proteins and concepts as possible to help demonstrate an understanding, eg. DNA Helicase, Okazaki Fragments, etc).
Draw out the molecular structure of a double stranded DNA molecule. This molecule is 6 bp in size. Don't forget label.
GD Label the sugar and phosphate. Label the bases that are not already labeled
DNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA fluoresces when illuminated with UV light the binding of a fluorescent dye that is easily detectable using radioactive antibodies that specifically bind to DNA the fact that DNA is blue and can be seen when millions of copies are present in a band
Page 1 of 3 ZOOM DNA Replication_Protein Synthesis_Mutation Assignment *Please type your answers. 1. DNA synthesis and protein synthesis are two processes that are necessary for the cell. Why are these two processes necessary for the cell? How are they connected to each other? wious 4+ 144
The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicase, primase, DNA polymerase III, DNA polymerase I and ligase. Also be sure to indicate the 5’ and 3’ ends of all nucleic acid polymers.
DNA WORKSHEET Use the following information to answer the next four questions. Nucleic Acid 3'TAGATTCCGATCGAAGGTTCCTAGCATGAACGATCAATTCCGG 1. Identify the type of nucleic acid found above. 2. Write the complementary strand for it. 3. If the replication fork occurs on either end of this strand open up the strand and place RNA primers in the appropriate places (one for the leading strand and two for the lagging strand). Using arrows show the direction of strand synthesis for each template strand and label each as leading for lagging strands. 4. If the RNA primer is four bases long identify the bases in the primer for each leading strand. The bases in bold indicate the location where the RNA primers would bind.
What is it about the structure of DNA that allows it to be replicated so exactly, thus making it so successful as the genetic material? Be specific and complete in your answer.