. Here is part of a gene: - 5' - 3' If the bottom strand of the DNA is the template strand, what will be the mRNA sequence and the amino acid sequence that are present in the W 3' TTTAATGGTAACCGTATTGCAGCTATTAGCATAAATG AAATTACCATTGGCATAACGTCGATAATCGTATTTAC 5'

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding…

A: In transcription, the template strand is the strand of DNA that serves as the template for the…

Q: What is the function of the transverse tubules? conduct ATP molecules out of the mitochondria…

A: Skeletal muscle is responsible for movement of various parts of the body and locomotion. This…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Introduction :  The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: None

A: Thes images is only for reference purposes

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…