
Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter ST.5, Problem 4RQ
Summary Introduction
To determine: The mechanism of glyphosate and its use to increase agricultural yields of genetically modified crops.
Introduction: Weeds are responsible for the destruction of almost 10% of crop production all over the world. Presence of weeds makes the crops nutrient deficient. The crops have to fight for nutrients as weeds take up the nutrients from the soil. Farmers use herbicides to destroy weeds in order to protect their crops.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter ST Solutions
Concepts of Genetics (11th Edition)
Ch. ST.1 - Prob. 1RQCh. ST.1 - Prob. 2RQCh. ST.1 - Prob. 3RQCh. ST.1 - Prob. 4RQCh. ST.1 - Prob. 5RQCh. ST.1 - Prob. 6RQCh. ST.1 - Prob. 7RQCh. ST.1 - How do microRNAs regulate epigenetic mechanisms...Ch. ST.1 - Prob. 9RQCh. ST.1 -
Imprinting disorders do not involve changes in...
Ch. ST.1 - Prob. 2DQCh. ST.1 - Prob. 3DQCh. ST.1 - Prob. 4DQCh. ST.2 - Prob. 1RQCh. ST.2 - Prob. 2RQCh. ST.2 - Prob. 3RQCh. ST.2 - Prob. 4RQCh. ST.2 - What are the three types of small noncoding RNAs...Ch. ST.2 - The mechanism for RNA-induced transcriptional...Ch. ST.2 - Prob. 7RQCh. ST.2 - Prob. 8RQCh. ST.2 - How and why are eukaryotic mRNAs transported and...Ch. ST.2 - The RNA World Hypothesis suggests that the...Ch. ST.2 - Prob. 2DQCh. ST.2 - Prob. 3DQCh. ST.2 - Prob. 4DQCh. ST.3 - What is VNTR profiling, and what are the...Ch. ST.3 - Prob. 2RQCh. ST.3 - Describe capillary electrophoresis. How does this...Ch. ST.3 - What are the advantages and limitations of...Ch. ST.3 - Prob. 5RQCh. ST.3 - Explain why mitochondrial DNA profiling is often...Ch. ST.3 - Prob. 7RQCh. ST.3 - Describe the database system known as CODIS. What...Ch. ST.3 - Prob. 9RQCh. ST.3 - Prob. 10RQCh. ST.3 - Given the possibility that synthetic DNA could be...Ch. ST.3 - Prob. 2DQCh. ST.3 - If you were acting as a defense lawyer in a murder...Ch. ST.3 - The phenomena of somatic mosaicism and chimerism...Ch. ST.4 - What is pharmacogenomics, and how does it differ...Ch. ST.4 - Describe how the drug Herceptin works. What types...Ch. ST.4 - Prob. 3RQCh. ST.4 - Prob. 4RQCh. ST.4 - Prob. 5RQCh. ST.4 - Prob. 6RQCh. ST.4 - Why is it necessary to examine gene-expression...Ch. ST.4 - Prob. 8RQCh. ST.4 - In this chapter, we present three case studies...Ch. ST.4 - Prob. 2DQCh. ST.4 - How can we ensure that a patients privacy is...Ch. ST.4 - As gene tests and genomic sequences become more...Ch. ST.5 - How do genetically modified organisms compare with...Ch. ST.5 - Prob. 2RQCh. ST.5 - Prob. 3RQCh. ST.5 - Prob. 4RQCh. ST.5 - Describe the mechanisms by which the Cry proteins...Ch. ST.5 - Prob. 6RQCh. ST.5 - Prob. 7RQCh. ST.5 - Describe how plants can be transformed using...Ch. ST.5 - How do positive and negative selection techniques...Ch. ST.5 - Prob. 10RQCh. ST.5 - What are the laws regulating the development,...Ch. ST.5 - Do you think that foods containing GM ingredients...Ch. ST.5 - Prob. 3DQCh. ST.6 - What is gene therapy?Ch. ST.6 - Prob. 2RQCh. ST.6 - When treating a person by gene therapy, is it...Ch. ST.6 - Describe two ways that therapeutic genes can be...Ch. ST.6 - Explain how viral vectors can be used for gene...Ch. ST.6 - Prob. 6RQCh. ST.6 - Explain an example of a successful gene therapy...Ch. ST.6 - Prob. 8RQCh. ST.6 - Prob. 9RQCh. ST.6 - Prob. 10RQCh. ST.6 - Prob. 1DQCh. ST.6 - Who should be treated by gene therapy? What...Ch. ST.6 - Prob. 3DQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningNutritional Sciences: From Fundamentals to Food, ...Health & NutritionISBN:9781337486415Author:McGuirePublisher:Cengage

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Nutritional Sciences: From Fundamentals to Food, ...
Health & Nutrition
ISBN:9781337486415
Author:McGuire
Publisher:Cengage
How do Plants Handle Stress?; Author: Alex Dainis;https://www.youtube.com/watch?v=TYsnveEHqec;License: Standard Youtube License