EBK BROCK BIOLOGY OF MICROORGANISMS
15th Edition
ISBN: 8220103633352
Author: Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9.10, Problem 1MQ
- Why is the term “proteome” ambiguous, whereas the term “genome” is not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
List reasons why the proteome is larger than the genome.
Given the following DNA, (A) what is the transcript (MRNA) sequence? (B)
What might be the amino acid sequence of the translated protein?
5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'
The human proteome contains a much greater variety of proteins than would be predicted from the human genome. What molecular phenomenon best explains this diversity?
Chapter 9 Solutions
EBK BROCK BIOLOGY OF MICROORGANISMS
Ch. 9.1 - How many protein-encoding genes are in the human...Ch. 9.1 - List three examples of how genomics has led to...Ch. 9.1 - What is one discovery resulting from the...Ch. 9.2 - What key molecules are essential for danger...Ch. 9.2 - Prob. 2MQCh. 9.2 - What is the major problem in identifying genes...Ch. 9.2 - How can protein homology assist in genome...Ch. 9.3 - What lifestyle is typical of Bacteria and Archaea...Ch. 9.3 - Prob. 2MQCh. 9.3 - Prob. 3MQ
Ch. 9.3 - Prob. 1CRCh. 9.4 - Prob. 1MQCh. 9.4 - Prob. 2MQCh. 9.4 - Prob. 3MQCh. 9.4 - Which genomes are larger, those of chloroplasts or...Ch. 9.5 - Prob. 1MQCh. 9.5 - Prob. 2MQCh. 9.5 - Prob. 3MQCh. 9.5 - What is the major difference in how duplications...Ch. 9.6 - Which class of genes is rarely transferred...Ch. 9.6 - List the major mechanisms by which horizontal gene...Ch. 9.6 - How might transposons be especially important in...Ch. 9.6 - Explain how horizontally transferred genes can be...Ch. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.7 - Explain how chromosomal islands might move between...Ch. 9.8 - Prob. 1MQCh. 9.8 - How is a metagenome analyzed?Ch. 9.8 - Prob. 1CRCh. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.9 - Prob. 1CRCh. 9.10 - Why is the term proteome ambiguous, whereas the...Ch. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.10 - Prob. 1CRCh. 9.11 - Prob. 1MQCh. 9.11 - What is a secondary metabolite?Ch. 9.11 - Prob. 1CRCh. 9.12 - How are single cells isolated from a mixed...Ch. 9.12 - Prob. 2MQCh. 9.12 - How can single-cell genomics be used to address...Ch. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 1CRCh. 9.14 - Prob. 1MQCh. 9.14 - Prob. 2MQCh. 9.14 - Prob. 1CRCh. 9 - Apart from genome size, what factors make complete...Ch. 9 - Describe how one might determine which proteins In...Ch. 9 - The gene encoding the beta subunit of RNA...Ch. 9 - Describe how you could use systems biology to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain about the proteome ?arrow_forwardThe central dogma of molecular biology states simply that DNA encodes RNA, and RNA encodes protein. For each of the following processes, describe, 1) where in the cell they occur, 2) one important protein (or protein containing complex) involved 3) the result of this process. DNA replication Where?) Protein?) Result?) Transcription Where?) Protein?) Result?) Splicing Where?) Protein?) Result?) Translation Where?) Protein?) Result?)arrow_forward14) Why are telomeres so important in eukaryotic organisms? A) Without telomeres, important DNA could be lost every time the cell divides. B) They cap the mRNA, allowing it to pass through the nuclear membrane to the cytoplasm fo translation. C) They provide a repetitive DNA sequence needed by primers to recognize the beginning of transcription. D) They remain relatively undamaged from environmental stress and toxins.arrow_forward
- The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forwardUse the first photo to answer the following questions.arrow_forward
- Suppose that a DNA segment has the following nucleotide sequence: CTC ATA CGA TTC AAG TTA. Which of the following nucleotide sequences would be found in a complementary mRNA strand? (a) GAG UAU GAU AAC UUG AAU. (b) GAG TAT GCT AAG TTC AAT. (c) GAG UAU GCU AAG UUC AAU. (d) GUG UAU GGA UUG AAC GGU.arrow_forwardWhich of the following terms is used for the various forms of any one a) Autosomes b ) Codons c) Allelt e ) Homozygousarrow_forwardWhich of the following is NOT true regarding the genetic code and translation? a) An mRNA is typically translated in only 1 reading frame. b) There are 64 different codons. c) Multiple amino acids may be coded for by a single codon. d) mRNA sequence is the reverse complement of the template strand of DNA.arrow_forward
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardWhy does release (the rate of release of minus ends from the nucleation site of the centrosome, allowing the depolymerization of minus ends) cause the decrease of the number and length of microtubules?arrow_forwardWhich one of the following statements about nucleosomes is false? a) The DNA double helix wraps around the nucleosome. b) The sequence of amino acid in a histone tail is altered during chromatin remodeling. c) A nucleosome is composed of 8 histone proteins; two copies of each type of histone. d) A large percent of the nucleosome is positively charged.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License