Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 17P
Explain in about one sentence why it is important to animals for the major carbohydrate storage
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the metabolic basis for the observation that many adults cannot ingest large quantities of milk without developing gastric difficulties?
What is the benefit of fiber in the diet?
Why is it advantageous that polysaccharides can have branched chains?
No animal can digest cellulose. Reconcile this statement with the fact that many animals are herbivores that depend heavily on cellulose as a food source.
Explain how it is possible that collagen is the most abundant protein of the human body, representing about 30% of its dry weight
Describe the process by which a fatty acid such aspalmitate (a C16 straight-chain saturated fatty acid) issynthesized in a cell.
Chapter 9 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 9 - Prob. 1PCh. 9 - -D-Galactopyranose rotates the plane of polarized...Ch. 9 - Provide an explanation for the fact that a-...Ch. 9 - Why is a type O individual considered a universal...Ch. 9 - The disaccharide , -trehalose differs from the ,...Ch. 9 - A reducing sugar will undergo the Fehling...Ch. 9 - Prob. 7PCh. 9 - Prob. 8PCh. 9 - Indicate whether the structures shown are R and S...Ch. 9 - Prob. 10P
Ch. 9 - Draw (using Haworth projections) the fragments of...Ch. 9 - One or more of the compounds shown below will...Ch. 9 - Why do you suppose that the influenza virus...Ch. 9 - Prob. 14PCh. 9 - Are mannose and galactose epimers? Allose and...Ch. 9 - Prob. 16PCh. 9 - Explain in about one sentence why it is important...Ch. 9 - Prob. 18PCh. 9 - Prob. 19PCh. 9 - Prob. 20PCh. 9 - Prob. 21PCh. 9 - Prob. 22PCh. 9 - Prob. 23P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Describe a pathway whereby some of the carbon from a fatty acid with an odd-numbered carbon chain could undergo a net conver- sion to carbohydrate.arrow_forwardWhat is the physiological purpose of starch in a seed or other plant tissue? What is the physiological purpose of glycogen in a mammal?arrow_forwardCompare the role of CTP in phosphoglyceride synthesis with the role of UTP in glycogen synthesis.arrow_forward
- Wasting is one of the characteristics of HIV / Aids, caused by increased metabolic activity. Untreated patients quickly lose up to 10% of their body weight, with loss of muscle mass contributing most. What happens to the amino group of amino acids that are broken down in the muscles? Fully explain the process of amino acid degradation in the muscle up to urea production in the liver.arrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardExplain how the biosynthesis of fatty acids from carbohydrates works(starting with the ingestion of starch and ending with a fatty acid).arrow_forward
- Compare the structures of proteoglycans and glycoproteins. How are structural differences related to their functions?arrow_forwardDescribe the structure of a glycogen molecule. What is the advantage of itsbranched structure?arrow_forwardDescribe the roles of glycerol 3- phosphate, phosphatidate, and diacylglycerol in triacylglycerol and phospholipid synthesis.arrow_forward
- Describe the relation between triacylglycerol synthesis and phospholipid synthesisarrow_forwardWhat is characteristically distinct about the amino acid composition of Collagen? Why is it so tightly packed?arrow_forwardProtein from a muscle is being used as a source of energy. Follow the catabolism of a single tryptophan in the myoglobin, starting with intact myoglobin in a muscle cell and continuing through the final product(s) eliminated from the body. Assume the tryptophan has been radiolabeled with Nitrogen-15 in all amino groups and Carbon-14 in the backbone alpha carbon. Track the progress of these radiolabeled atoms through the various metabolic intermediates (showing the label in each of the intermediate molecules) until they are eliminated from the body.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license