EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
| a. | Asn at position 10 in protein A is changed to Tyr. |
| b. | Leu at position 12 in protein A is changed to Pro. |
| c. | Gln at position 8 in protein B is changed to Leu. |
| d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why are nutrient absorption and dosage levels important when taking multivitamins and vitamin and mineral supplements?
I'm struggling with this topic and would really appreciate your help. I need to hand-draw a diagram and explain the process of sexual differentiation in humans, including
structures, hormones, enzymes, and other details.
Could you also make sure to include these terms in the explanation?
. Gonads
. Wolffian ducts
• Müllerian ducts
.
⚫ Testes
. Testosterone
• Anti-Müllerian Hormone (AMH)
. Epididymis
• Vas deferens
⚫ Seminal vesicles
⚫ 5-alpha reductase
⚫ DHT
- Penis
. Scrotum
. Ovaries
• Uterus
⚫ Fallopian tubes
- Vagina
- Clitoris
. Labia
Thank you so much for your help!
Requisition Exercise
A phlebotomist goes to a patient’s room with the following requisition.
Hometown Hospital USA 125 Goodcare Avenue Small Town, USA
Chapter 8 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- I’m struggling with this topic and would really appreciate your help. I need to hand-draw a diagram and explain the process of sexual differentiation in humans, including structures, hormones, enzymes, and other details. Could you also make sure to include these terms in the explanation? • Gonads • Wolffian ducts • Müllerian ducts • Testes • Testosterone • Anti-Müllerian Hormone (AMH) • Epididymis • Vas deferens • Seminal vesicles • 5-alpha reductase • DHT • Penis • Scrotum • Ovaries • Uterus • Fallopian tubes • Vagina • Clitoris • Labia Thank you so much for your help!arrow_forwardI’m struggling with this topic and would really appreciate your help. I need to hand-draw a diagram and explain the process of sexual differentiation in humans, including structures, hormones, enzymes, and other details. Could you also make sure to include these terms in the explanation? • Gonads • Wolffian ducts • Müllerian ducts • Testes • Testosterone • Anti-Müllerian Hormone (AMH) • Epididymis • Vas deferens • Seminal vesicles • 5-alpha reductase • DHT • Penis • Scrotum • Ovaries • Uterus • Fallopian tubes • Vagina • Clitoris • Labia Thank you so much for your help!arrow_forwardOlder adults have unique challenges in terms of their nutrient needs and physiological changes. Some changes may make it difficult to consume a healthful diet, so it is important to identify strategies to help overcome these obstacles. From the list below, choose all the correct statements about changes in older adults. Select all that apply. Poor vision can make it difficult for older adults to get to a supermarket, and to prepare meals. With age, taste and visual perception decline. As people age, salivary production increases. In older adults with dysphagia, foods like creamy soups, applesauce, and yogurt are usually well tolerated. Lean body mass increases in older adults.arrow_forward
- When physical activity increases, energy requirements increase also. Depending on the type, intensity, and duration of physical activity, the body’s requirements for certain macronutrients may change as well. From the list below, choose all the correct statements about the effects of increased physical activity or athletic training. Select all that apply. An athlete who weighs 70 kg (154 lb) should consume 420 to 700 g of carbohydrate per day. How much additional energy an athlete needs depends on the specific activity the athlete engages in and the frequency of the activity. Those participating in vigorous exercise should restrict their fat intake to less than 15%% of total energy intake. Athletes who are following energy-restricted diets are at risk for consuming insufficient protein. The recommendation to limit saturated fat intake to less than 10%% of total energy intake does not apply to athletes or those who regularly engage in vigorous physical activity.arrow_forwardWhen taking vitamins and vitamin-mineral supplements, how can one be sure they are getting what they are taking?arrow_forwardHow many milligrams of zinc did you consume on average per day over the 3 days? (See the Actual Intakes vs. Recommended Intakes Report with all days checked.) Enter the number of milligrams of zinc rounded to the first decimal place in the box below. ______ mg ?arrow_forward
- the direct output from molecular replacement is a coordinate file showing the orientation of the unknown target protein in the unit cell. true or false?arrow_forwardthe direct output from molecular replacement is a coordinate file showing the orientation of the unknown target protein in the unit cell. true or false?arrow_forwardDid your intake of vitamin C meet or come very close to the recommended amount? yes noarrow_forward
- Which of the following statements about hydration is true? Absence of thirst is a reliable indication that an individual is adequately hydrated. All of these statements are true. Although a popular way to monitor hydration status, weighing yourself before and after intensive physical activity is not a reliable method to monitor hydration. Urine that is the color of apple juice indicates dehydration. I don't know yetarrow_forwardThree of the many recessive mutations in Drosophila melanogaster that affect body color, wing shape, or bristle morphology are black (b) body versus grey in wild type, dumpy (dp), obliquely truncated wings versus long wings in the male, and hooked (hk) bristles versus not hooked in the wild type. From a cross of a dumpy female with a black and hooked male, all of the F1 were wild type for all three of the characters. The testcross of an F1 female with a dumpy, black, hooked male gave the following results: Trait Number of individuals Wild type 169 Black 19 Black, hooked 301 Dumpy, hooked 21 Hooked, dumpy, black 172 Dumpy, black 6 Dumpy 305 Hooked 8 Determine the order of the genes and the mapping distance between genes. Determine the coefficient of confidence for the portion of the chromosome involved in the cross. How much interference takes place in the cross?arrow_forwardWhat happens to a microbes membrane at colder temperature?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY