EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
a. | Asn at position 10 in protein A is changed to Tyr. |
b. | Leu at position 12 in protein A is changed to Pro. |
c. | Gln at position 8 in protein B is changed to Leu. |
d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
a. What percentage of a drug is eliminated after 4 half-lives? Please round to the nearest percent.
b. What will happen to elimination of the drug in the previous question if the system is saturated? explain and show any math involved
If you wanted to reduce the difference between peak and trough levels that occur with repeated administration of a drug, how would you adjust the dose and dose interval without changing the plateau concentration (plateau is the average of peak and trough levels)? Select your answers for both dose and interval. Hint: It may be helpful to think about this problem using an example such as food. How would you eat if you wanted to maintain very steady hunger/satiety levels without changing your total caloric intake?
Options:
A. Dose; Increase dose
B. Dose; Decrease dose
C. Dose; Do not change dose
D. Interval; Increase the interval between doses (give the drug less frequently)
E. Interval; Decrease the interval between doses (give the drug more frequently)
F. Interval; Do not change the interval
What percentage of a drug is eliminated after 4 half-lives? Please round to the nearest percent. Show the math
Chapter 8 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Briefly explain the 6 domain of interprofessional collaboration: Role clarification, Team functioning, Interprofessional communication, Patient/client/family/community-centered care, Interprofessional conflict resolution, Collaborative leadership. Provide a specific negative events that nursing student would observe in a clinical setting for each domain.arrow_forwardwhat is an intermittent water course and what kind of fish habitat it would providearrow_forwardwhy are native freshwater mussels are an important part of great lakes ecosystemarrow_forward
- what morphological features differentiate the lamprey species and other species in the great lakesarrow_forwardThere are a wide range of therapeutic applications available as options for patients. Medical professionals should be aware of these applications so they can make informed recommendations to patients. To gain a better understanding of some therapeutic applications and how they are related to RNA and mRNA, research long non-coding RNA. Respond to the following in a minimum of 175 words: What is lncRNA and what does it do? How does IncRNA differ from mRNA? What are some therapeutic applications associated with lncRNA? Think about possible future uses of this application. What are the advantages and disadvantages of this application and its continued use?arrow_forwardfour fish or mussel species that are native to the great lakesarrow_forward
- There are a wide range of therapeutic applications available as options for patients. Medical professionals should be aware of these applications so they can make informed recommendations to patients. To gain a better understanding of some therapeutic applications and how they are related to RNA and mRNA, research long non-coding RNA. Respond to the following in a minimum of 175 words: What is lncRNA and what does it do? How does IncRNA differ from mRNA? What are some therapeutic applications associated with lncRNA? Think about possible future uses of this application. What are the advantages and disadvantages of this application and its continued use?arrow_forwardfour physial characteristics of a fish or a mussel that would help you identify it to a speciesarrow_forwarddescribe what you would do in this situation, you are working ona. river and it will take 20 minutes by boat to get back to the field truck, you are 1 hour from finishing the field work on the last day of field trip. you hear thunder int he dsitnace, what did you do?arrow_forward
- unu grow because auxin is still produced in the tip to Another of Boysen and Jensen's experiments included the use of mica, explain why one of the shoots was able to show phototropism and the other was not. Mica Wafer Ligh c. They then t but this time permeable n shoot. Why phototropis Light Mica Wafer Coleoptile tips Tips removed: agar Explain why the shoo direction after the ag the cut shoot, even tarrow_forwardDiscussion entries must be at least 250 words to fulfill the assignment requirements. You must complete your entry before you will be able to see the responses of other students. Responses to other students are encouraged but not required. Grading for discussion entries will be based on application of course concepts, proper grammar, and correct punctuation. Read one the attached article and explore the Human Development Index (https://hdr.undp.org/data-center/human-development-index#/indicies/HDI). In your opinion, is the Human Development Index a good measure of the well- being of the people of a nation? Are the items measured in the HDI valid and relevant in the modern global economy? How are they related to the political economy of a nation? The attached articles propose some alternative measures of well-being. In your opinion, are there other measures of well-being that might be better alternatives to the items in the current HDI?arrow_forwardA patient visits her doctor with symptoms typical of a bladder infection. She is immediately prescribed an 800 mgdose of antibiotic (bioavailability = 1/2, t½ = 12 h). The corresponding plasma concentration of drug is found to be 96 micrograms/ml. What is the volume of distribution of this drug? Please round to the nearest liter.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY