EBK GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260041255
Author: HARTWELL
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 33P
The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.
5′ CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3′
3′ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5′
a. | Which strand is the template strand? In which direction (right-to-left or left-to-right) does RNA polymerase move along the template as it transcribes this gene? |
b. | What is the sequence of the |
c. | A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The shape of radishes may be long (SL/SL), oval (SL/SS), or round (SS/SS), and the color of radishes may be red (CR/CR), purple (CR/CW) or white (CW/CW). If a long, red radish plant is crossed with a round, white plant, what will be the appearance of the F1 and F2 generations?
None
Question #3:
In the KeyGene paper, the authors state that it would be useful if pollen from an apomict would
transmit apomixis-inducing genes to the female in the cross (assuming the pollen is viable). Assuming
there was just one gene conferring gametophytic obligate apomixis, and that the two parents are
inbreds, what would be the consequences of such a cross if:
a) The apomixis was a dominant trait? Indicate the genotypes and phenotypes (apomict or non-
apomict) of the parents, F1 and F2 generations. Remember to include the expected genotypic
and phenotypic ratios (or percentages) in the F1 and F2 generations, and to position the female
first (left side) in the parental cross.
b) The apomixis was a recessive trait? Indicate the genotypes and phenotypes (apomict or non-
apomict) of the parents, F1 and F2 generations. Remember to include the expected genotypic
and phenotypic ratios (or percentages) in the F1 and F2 generations, and to position the female
first (left side) in the…
Chapter 8 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Question #5: Assume that two genes are identified that confer gametophytic facultative apomixis in soybean. The genes show independent assortment. Recessive alleles at both loci are required for the facultative apomixis. Facultative apomixis is triggered when the temperature at pollination is above 20 degrees C. At temperatures below 20 degrees C, all reproduction is sexual, independent of genotype. A facultative apomict male, capable of producing viable pollen, was crossed with a sexually reproducing female. Assuming the parents are completely inbred, what are the predicted phenotypic ratios (apomict: non-apomict) for the F1, F2, and DH (F1-derived) generations at each of the following temperatures*: a) 15°C? b) 25°C? *for full credit, show crosses and genotypes where appropriate. Remember to position the female first (left side) in the cross. Type your answer here:arrow_forwarda. What percentage of a drug is eliminated after 4 half-lives? Please round to the nearest percent. b. What will happen to elimination of the drug in the previous question if the system is saturated? explain and show any math involvedarrow_forwardIf you wanted to reduce the difference between peak and trough levels that occur with repeated administration of a drug, how would you adjust the dose and dose interval without changing the plateau concentration (plateau is the average of peak and trough levels)? Select your answers for both dose and interval. Hint: It may be helpful to think about this problem using an example such as food. How would you eat if you wanted to maintain very steady hunger/satiety levels without changing your total caloric intake? Options: A. Dose; Increase dose B. Dose; Decrease dose C. Dose; Do not change dose D. Interval; Increase the interval between doses (give the drug less frequently) E. Interval; Decrease the interval between doses (give the drug more frequently) F. Interval; Do not change the intervalarrow_forward
- What percentage of a drug is eliminated after 4 half-lives? Please round to the nearest percent. Show the matharrow_forwardBriefly explain the 6 domain of interprofessional collaboration: Role clarification, Team functioning, Interprofessional communication, Patient/client/family/community-centered care, Interprofessional conflict resolution, Collaborative leadership. Provide a specific negative events that nursing student would observe in a clinical setting for each domain.arrow_forwardwhat is an intermittent water course and what kind of fish habitat it would providearrow_forward
- why are native freshwater mussels are an important part of great lakes ecosystemarrow_forwardwhat morphological features differentiate the lamprey species and other species in the great lakesarrow_forwardThere are a wide range of therapeutic applications available as options for patients. Medical professionals should be aware of these applications so they can make informed recommendations to patients. To gain a better understanding of some therapeutic applications and how they are related to RNA and mRNA, research long non-coding RNA. Respond to the following in a minimum of 175 words: What is lncRNA and what does it do? How does IncRNA differ from mRNA? What are some therapeutic applications associated with lncRNA? Think about possible future uses of this application. What are the advantages and disadvantages of this application and its continued use?arrow_forward
- four fish or mussel species that are native to the great lakesarrow_forwardThere are a wide range of therapeutic applications available as options for patients. Medical professionals should be aware of these applications so they can make informed recommendations to patients. To gain a better understanding of some therapeutic applications and how they are related to RNA and mRNA, research long non-coding RNA. Respond to the following in a minimum of 175 words: What is lncRNA and what does it do? How does IncRNA differ from mRNA? What are some therapeutic applications associated with lncRNA? Think about possible future uses of this application. What are the advantages and disadvantages of this application and its continued use?arrow_forwardfour physial characteristics of a fish or a mussel that would help you identify it to a speciesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY