Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 24RE
Interpretation Introduction
Interpretation:
The two recent allosteric drugs that are currently in the market and their action.
Concept introduction:
Allosteric drugs employ the concepts of allosteric modulation. Allosteric modulation refers to the regulation of the activity of an enzyme when the effector molecule binds to the enzyme at a site other than the enzyme's active site. The effector molecule can be activator or inhibitor, which can increase the activity of an enzyme or can decrease the activity of the enzyme. Allosteric drugs use allosteric modulation.
The target molecule is the hormone or neurotransmitter and it binds to the receptor for initiating or inhibiting a
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
35 Biochemical Connections which would be better to eat before an exam, a glass of milk or a piece of cheese? Why?
Chapter 7 Solutions
Biochemistry
Ch. 7 - RECALL What features distinguish enzymes that...Ch. 7 - RECALL What is the metabolic role of aspartate...Ch. 7 - RECALL What molecule acts as a positive effector...Ch. 7 - RECALL Is the term KM used with allosteric...Ch. 7 - Prob. 5RECh. 7 - Prob. 6RECh. 7 - RECALL What is a homotropic effect? What is a...Ch. 7 - RECALL What is the structure of ATCase?Ch. 7 - RECALL How is the cooperative behavior of...Ch. 7 - RECALL Does the behavior of allosteric enzymes...
Ch. 7 - RECALL Does the behavior of allosteric enzymes...Ch. 7 - RECALL Explain what is meant by K0.5.Ch. 7 - REFLECT AND APPLY Explain the experiment used to...Ch. 7 - RECALL Distinguish between the concerted and...Ch. 7 - RECALL Which allosteric model can explain negative...Ch. 7 - RECALL With the concerted model, what conditions...Ch. 7 - Prob. 17RECh. 7 - Prob. 18RECh. 7 - Prob. 19RECh. 7 - Prob. 20RECh. 7 - Prob. 21RECh. 7 - BIOCHEMICAL CONNECTIONS How does Valium work?Ch. 7 - Prob. 23RECh. 7 - Prob. 24RECh. 7 - RECALL What is the function of a protein kinase?Ch. 7 - RECALL What amino acids are often phosphorylated...Ch. 7 - REFLECT AND APPLY What are some possible...Ch. 7 - REFLECT AND APPLY Explain how phosphorylation is...Ch. 7 - REFLECT AND APPLY Explain how glycogen...Ch. 7 - Prob. 30RECh. 7 - Prob. 31RECh. 7 - RECALL Name three proteins that are subject to the...Ch. 7 - Prob. 33RECh. 7 - RECALL What are caspases?Ch. 7 - REFLECT AND APPLY Explain why cleavage of the bond...Ch. 7 - REFLECT AND APPLY Why is it necessary or...Ch. 7 - Prob. 37RECh. 7 - Prob. 38RECh. 7 - Prob. 39RECh. 7 - RECALL What are the two essential amino acids in...Ch. 7 - RECALL Why does the enzyme reaction for...Ch. 7 - REFLECT AND APPLY Briefly describe the role of...Ch. 7 - REFLECT AND APPLY Explain the function of...Ch. 7 - REFLECT AND APPLY Explain why the second phase of...Ch. 7 - Prob. 45RECh. 7 - REFLECT AND APPLY An inhibitor that specifically...Ch. 7 - REFLECT AND APPLY What properties of metal ions...Ch. 7 - RECALL In biochemistry mechanisms, what group is...Ch. 7 - Prob. 49RECh. 7 - REFLECT AND APPLY Explain the difference between...Ch. 7 - Prob. 51RECh. 7 - Prob. 52RECh. 7 - Prob. 53RECh. 7 - REFLECT AND APPLY What is the relationship between...Ch. 7 - Prob. 55RECh. 7 - BIOCHEMICAL CONNECTIONS Why can cocaine addiction...Ch. 7 - Prob. 57RECh. 7 - Prob. 58RECh. 7 - RECALL How are coenzymes related to vitamins?Ch. 7 - RECALL What type of reaction uses vitamin B6?Ch. 7 - Prob. 61RECh. 7 - Prob. 62RECh. 7 - Prob. 63RECh. 7 - BIOCHEMICAL CONNECTIONS What are some of the ways...Ch. 7 - Prob. 65RECh. 7 - Prob. 66RECh. 7 - Prob. 67RECh. 7 - Prob. 68RECh. 7 - Prob. 69RECh. 7 - Prob. 70RECh. 7 - Prob. 71RECh. 7 - Prob. 72RECh. 7 - Prob. 73RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- BIOCHEMICAL CONNECTIONS You have been hired by a pharmaceutical company to work on development of drugs to treat AIDS. What information from this chapter will be useful to you?arrow_forwardBIOCHEMICAL CONNECTIONS Beriberi is a disease caused by a deficiency of vitamin B1 (thiamine) in the diet. Thiamine is the precursor of thiamine pyrophosphate. In view of what you have learned in this chapter, why is it not surprising that alcoholics tend to develop this disease?arrow_forwardBIOCHEMICAL CONNECTIONS Cancer cells grow so rapidly that they have a higher rate of anaerobic metabolism than most body tissues, especially at the center of a tumor. Can you use drugs that poison the enzymes of anaerobic metabolism in the treatment of cancer? Why, or why not?arrow_forward
- REFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG3' Reverse primer 5'TTCTAAGAAACTGTTAAGG3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC3' Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG3' Reverse primer 5'CGGACCTTCATTGGCAATTCGA3'arrow_forwardREFLECT AND APPLY A mutation that changes an alanine residue in a protein to an isoleucine leads to a loss of activity. Activity is regained when a further mutation at the same site changes the isoleucine to a glycine. Why?arrow_forwardBIOCHEMICAL CONNECTIONS You are planning to go on a strenuous hike and are advised to eat plenty of high-carbohydrate foods, such as bread and pasta, for several days beforehand. Suggest a reason for the advice.arrow_forward
- REFLECT AND APPLY Why is a trimming process important in converting precursors of tRNA and rRNA to the active forms?arrow_forwardBIOCHEMICAL CONNECTIONS Why do scientists believe that the sickle-cell trait has not evolved out of the human population yet considering how deadly it is to be homozygous for the sickle cell gene?arrow_forwardBIOCHEMICAL CONNECTIONS What is the direct cause of sickle- cell anemia (think primary structure)?arrow_forward
- REFLECT AND APPLY Why is it not surprising that the addition of nucleotides to a growing DNA chain takes place by nucleophilic substitution?arrow_forwardREFLECT AND APPLY Suppose that you are a prosecuting attorney. How has the introduction of the polymerase chain reaction changed your job?arrow_forwardREFLECT AND APPLY Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit, instead of an 80S subunit.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY