At least eight other post-translational modifications and the amino acid residues involved in post translational protein modifications needs to be determined. Concept Introduction : The covalent and the enzymatic proteins modification subsequent to protein biosynthesis are known as PTM i.e. Post-translational modification. The ribosomes translate mRNA into polypeptide chains to synthesize proteins that can undergo post-translational modification to produce the protein product that is comparatively mature.

Question

Discuss the key factors & mechanisms during co-translational translocation by which START TRANSFER and STOP TRANSFER sequences help the protein generate appropriate number of transmembrane regions with N or C terminal on the designated side of the plasma membrane.(NO PLAGIARISM)

Answer 1

Question

Chapter 31, Problem 16P

Interpretation Introduction

Interpretation :

At least eight other post-translational modifications and the amino acid residues involved in post translational protein modifications needs to be determined.

Concept Introduction :

The covalent and the enzymatic proteins modification subsequent to protein biosynthesis are known as PTM i.e. Post-translational modification. The ribosomes translate mRNA into polypeptide chains to synthesize proteins that can undergo post-translational modification to produce the protein product that is comparatively mature.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

Discuss the key factors & mechanisms during co-translational translocation by which START TRANSFER and STOP TRANSFER sequences help the protein generate appropriate number of transmembrane regions with N or C terminal on the designated side of the plasma membrane.(NO PLAGIARISM)

Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?

Explain post-translational modification of proteins in general with the types of reactions. Provide some examples of proteins that undergo post-translational modification. What are the protein targets, the type of reaction, and purpose or functions of this post-translational modification, then look up other resources to find other functions of lysyl-tRNA synthetase and explain