ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
12th Edition
ISBN: 9781319401399
Author: Griffiths
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Question
Chapter 3, Problem 1P
Summary Introduction
To determine: The following -
- a. The probability of X2 17 with 9 pdf.
- b. The probability of X2 17 with 6 pdf.
- c. The rule that is seen in both the calculations.
Introduction. Probability is a mathematical term that is used in mathematics to find out the events that are occurred or about to occur. It is also used in genetics to find out the events which are occurred among the traits or genes,
Expert Solution & Answer

Explanation of Solution
- a. The X2 17 are lies in the p 0.1, as clearly seen in table 3-1 in page number 36 of chapter 3. The probability of the X2 17 with nine pdf is –
- 0.1 X 100 = 10.
Hence the probability is 10%.
- b. The X2 17 are lies in the p 0.1, as clearly seen in table 3-1 in page number 36 of chapter 3. The probability of the X2 17 with six pdf is –
- 0.2 X 100 = 10.
Hence the probability is 10%.
- c. The rules that are found in both the calculations are that the probability value is found based on the table is not accurate but can be found as an approximate value. The p>0.05 of a hypothesis is considered to be accurate, and p<0.05 is considered to be false.
Want to see more full solutions like this?
Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 3 Solutions
ACHIEVE:INTRO TO GENETIC ANALYSIS 1TERM
Ch. 3 - Prob. 1PCh. 3 - Prob. 2PCh. 3 - Prob. 3PCh. 3 - Prob. 4PCh. 3 - Prob. 5PCh. 3 - Prob. 6PCh. 3 - Prob. 7PCh. 3 - Prob. 8PCh. 3 - Prob. 9PCh. 3 - Prob. 10P
Ch. 3 - Prob. 11PCh. 3 - Prob. 12PCh. 3 - Prob. 13PCh. 3 - Prob. 14PCh. 3 - Prob. 15PCh. 3 - Prob. 16PCh. 3 - Prob. 17PCh. 3 - Prob. 18PCh. 3 - Prob. 19PCh. 3 - Prob. 20PCh. 3 - Prob. 21PCh. 3 - Prob. 22PCh. 3 - Prob. 23PCh. 3 - Prob. 24PCh. 3 - Prob. 25PCh. 3 - Prob. 26PCh. 3 - Prob. 27PCh. 3 - Prob. 28PCh. 3 - Prob. 29PCh. 3 - Prob. 30PCh. 3 - Prob. 31PCh. 3 - Prob. 32PCh. 3 - Prob. 33PCh. 3 - Prob. 34PCh. 3 - Prob. 35PCh. 3 - Prob. 36PCh. 3 - Prob. 37PCh. 3 - Prob. 38PCh. 3 - Prob. 39PCh. 3 - Prob. 40PCh. 3 - Prob. 41PCh. 3 - Prob. 42PCh. 3 - Prob. 43PCh. 3 - Prob. 43.1PCh. 3 - Prob. 43.2PCh. 3 - Prob. 43.3PCh. 3 - Prob. 43.4PCh. 3 - Prob. 43.5PCh. 3 - Prob. 43.6PCh. 3 - Prob. 43.7PCh. 3 - Prob. 43.8PCh. 3 - Prob. 43.9PCh. 3 - Prob. 43.10PCh. 3 - Prob. 43.11PCh. 3 - Prob. 43.12PCh. 3 - Prob. 43.13PCh. 3 - Prob. 43.14PCh. 3 - Prob. 43.15PCh. 3 - Prob. 44PCh. 3 - Prob. 45PCh. 3 - Prob. 46PCh. 3 - Prob. 47PCh. 3 - Prob. 48PCh. 3 - Prob. 49PCh. 3 - Prob. 50PCh. 3 - Prob. 51PCh. 3 - Prob. 52PCh. 3 - Prob. 53PCh. 3 - Prob. 54PCh. 3 - Prob. 55PCh. 3 - Prob. 56PCh. 3 - Prob. 57PCh. 3 - Prob. 58PCh. 3 - Prob. 59PCh. 3 - Prob. 61PCh. 3 - Prob. 62PCh. 3 - Prob. 63PCh. 3 - Prob. 64PCh. 3 - Prob. 65PCh. 3 - Prob. 66PCh. 3 - Prob. 67PCh. 3 - Prob. 70PCh. 3 - Prob. 1GSCh. 3 - Prob. 2GSCh. 3 - Prob. 3GS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Introduction to the NIOSH Manual of Analytical Methods Fifth edition; Author: Centers for Disease Control and Prevention (CDC);https://www.youtube.com/watch?v=B5rUrKLMoas;License: Standard Youtube License