
Anatomy & Physiology
5th Edition
ISBN: 9780321861580
Author: Marieb, Elaine N.
Publisher: Pearson College Div
expand_more
expand_more
format_list_bulleted
Question
Chapter 23, Problem 25CYU
Summary Introduction
To review:
The choice to prefer high blood levels of HDLs or LDLs.
Introduction:
Cholesterol and triglycerides are insoluble in water and are unable to circulate freely in blood. Thus, they are bound to small complexes called lipoproteins. Lipoproteins are made up of proteins and lipids, which can transport in and out of the cells. They can be of two types: HDL and LDL, based on their composition of lipids and proteins.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 23 Solutions
Anatomy & Physiology
Ch. 23 - Prob. 1CYUCh. 23 - Why is it important to include cellulose in a...Ch. 23 - How does the body use triglycerides? Cholesterol?Ch. 23 - Prob. 4CYUCh. 23 - Prob. 5CYUCh. 23 - Prob. 6CYUCh. 23 - Prob. 7CYUCh. 23 - What is a redox reaction?Ch. 23 - How are anabolism and catabolism linked by ATP?Ch. 23 - What is the energy source for the proton pumps of...
Ch. 23 - Briefly, how do substrate-level and oxidative...Ch. 23 - What happens in glycolysis if oxygen and pyruvic...Ch. 23 - 13. What two major kinds of chemical reactions...Ch. 23 - What name is given to the chemical reaction in...Ch. 23 - Prob. 15CYUCh. 23 - Prob. 16CYUCh. 23 - Prob. 17CYUCh. 23 - What are the products of beta oxidation?Ch. 23 - Prob. 19CYUCh. 23 - Prob. 20CYUCh. 23 - Which three organs or tissues are the primary...Ch. 23 - Prob. 22CYUCh. 23 - Which hormone is glucagons main antagonist?Ch. 23 - Which event increases both glucagon and insulin...Ch. 23 - Prob. 25CYUCh. 23 - Prob. 28CYUCh. 23 - What is the most important long-term regulator of...Ch. 23 - Prob. 30CYUCh. 23 - Prob. 31CYUCh. 23 - Prob. 32CYUCh. 23 - Prob. 33CYUCh. 23 - Prob. 34CYUCh. 23 - Prob. 26CYUCh. 23 - Prob. 27CYUCh. 23 - Which of the following reactions would liberate...Ch. 23 - The formation of glucose from glycogen is (a)...Ch. 23 - The net gain of ATP from the complete metabolism...Ch. 23 - Which of the following best defines cellular...Ch. 23 - What is formed during aerobic respiration when...Ch. 23 - Prob. 6RQCh. 23 - Prob. 7RQCh. 23 - Which of the following is not a function of the...Ch. 23 - Prob. 9RQCh. 23 - A person has been on a hunger strike for seven...Ch. 23 - Transamination is a chemical process by which (a)...Ch. 23 - Three days after removing the pancreas from an...Ch. 23 - Hunger, appetite, obesity, and physical activity...Ch. 23 - Prob. 14RQCh. 23 - Which of the following yields the greatest caloric...Ch. 23 - What is cellular respiration? What is the common...Ch. 23 - Describe the site, major events, and outcomes of...Ch. 23 - Pyruvic acid is a product of glycolysis, but it is...Ch. 23 - Prob. 19RQCh. 23 - Prob. 20RQCh. 23 - Prob. 21RQCh. 23 - Prob. 22RQCh. 23 - Prob. 23RQCh. 23 - What is meant by body energy balance, and what...Ch. 23 - Explain the effect of the following on metabolic...Ch. 23 - Prob. 26RQCh. 23 - Prob. 27RQCh. 23 -
Kyle Boulard, a 35-year-old male, is believed to...Ch. 23 - Kyle Boulard, a 35-year-old male, is believed to...Ch. 23 - Kyle Boulard, a 35-year-old male, is believed to...Ch. 23 - Kyle Boulard, a 35-year-old male, is believed to...Ch. 23 - Kyle Boulard, a 35-year-old male, is believed to...
Knowledge Booster
Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Health Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage