Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21.5, Problem 2CC
Explain how multiple exons might have arisen in the ancestral EGF and fibronectin genes shown on the left side of Figure 21.16.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In Figure 9-12(b), what do you think happens to the tRNA that is released from the E site?
In the module, you have learned about P-element mediated transgenesis in Drosophila and the concept of using transgenes to rescue mutant phenotypes. In the figure below, you will see a wild type fly with its natural eye colour and three mutants with their eye colours changed to vermillion, white and rosy, respectively. A schematic of P-element mediated transgenesis (as shown in the lectures) is also included in the figure. Please inspect the schematic carefully and choose which of the following statements is true:
I.
Injection of the white experimental transgene into the vermillion mutant embryo will not change the vermillion mutant phenotype
II.
Injection of the white experimental transgene in the rosy mutant embryo will change rosy eye colour to red (wild type)
III.
Injection of the white experimental transgene in the white mutant embryo will not change the white mutant phenotype
IV.
Injection of the white experimental transgene in the rosy mutant…
a)
hours: 0 2 567
DMC1
SPS1
hours: 0 2 5 6 7 9 11
DIT1
SPS100
Oxygen level (% normal)
b)
120
100
FIGURE 4.6. Comparison of Northern blots with DNA microarray
data. a) Results from four individual Northern blots examining four different
genes and measuring mRNA production over time, as indicated. b) Results
from a series of microarrays for the same four genes of interest. Note the color
scale on the bottom of b), where bright green indicates a 20-fold repression
and bright red indicates a 20-fold induction. Black indicates no change in
transcription (i.e., the merged microarray spot would have appeared yellow).
80
60
40
20
0 1 2
gene X
gene Y
gene Z
3
1
hour
1.0
1.0
b)
1.0
hours: 0.5 2 5 7 9 11
DMC1
SPS1
DIT1
SPS100
fold repressed
>20 10x 3x3x10x >20
1:1
fold induced
4 5 6 7 8 9 10 11
Time (hours)
3
hour
2.2
4.5
1.5
5
9
hour
hour
1.0
0.15
0.95 0.05
2.0
2.0
FIGURE 4.7 Transcriptional response of three genes
to the gradual loss of oxygen. a) Graph of oxygen con-
sumption over time by…
Chapter 21 Solutions
Campbell Biology: Custom Edition
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Additional Science Textbook Solutions
Find more solutions based on key concepts
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
HUMAN ANATOMY
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (8th Edition)
60. The solar system is 25,000 light years from the center of our Milky Way galaxy. One light year is the dista...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Give the IUPAC name for each compound.
Organic Chemistry
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain how the following mutations would affect transcription of the yeast GAL1 gene in the presence of galactose. (a) A deletion within the GAL4 gene that removes the region encoding amino acids 1 to 100. (b) A deletion of the entire GAL3 gene. (c) A mutation within the GAL80 gene that blocks the ability of Gal80 protein to interact with Gal3p. (d) A deletion of one of the four UASG elements upstream from the GAL1 gene. (e) A point mutation in the GAL1 core promoter that alters the sequence of the TATA box.arrow_forwardThe attached table below shows the reference and a diseased patient's DMD genes in the hip flexor which, if mutated, can cause muscular dystophy. Analyze the table, make the coding strand, and explain how and which mutation in the patien's genes caused muscular dystrophyarrow_forwardThe transcription factor Pax6 is required continually during the life of a mouse (or a human) for the development of the retina. Homozygous Pax6 knockout mice die soon after birth because Pax6 protein is also required in essential organs, such as the pancreas. a) In order to study the role of Pax6 in eye development a researcher wants to generate a mouse that expresses Pax6 everywhere except in its eyes. Describe how you could construct such a mouse by floxing the gene. Is it possible to achieve the same end with a transgene? (Hint: think about using cDNA and RNAI) b) Suppose you want to create a mouse similar to that in part (a), but one where the eye cells from Pax6 function has been removed and now express a gene that specifies a green fluorescent protein (GFP). Marking the cells in this way will allow the investigators to see the shapes of the Pax6- eye cells more easily than if they did not express GFP. Diagram a Pax6 gene construct that would enable the researcher to do this…arrow_forward
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardThe figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.arrow_forwardThe genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over 200,000proteins. Propose two processes that, taken together, account for this discrepancyarrow_forward
- Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…arrow_forwardYou are working with a fly hair cell developmental system. This Notch/Delta-regulated system results in clusters of cells where the central one differentiates into a specialized hair cell. To better understand this system you have tagged the C-terminal cytoplasmic domain of Notch with GFP. You have done a forward genetic screen to look for mutants that have unusual phenotypes in this Notch system. The first one is a mutation in Notch itself. This mutant is in the ADAM10 cleavage site and blocks proteolysis. Draw the expected outcome for such a mutant: GFP localization and developmental outcome 24hr after differentiation. WT before differentiation WT 24 hours after differentiationarrow_forwardYou would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forward
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardFor each of the following situations, provide a plausible explanation for how it could lead to unrestricted cell division.(a) Colon cancer cells often contain mutations in the gene encoding the prostaglandin E2 receptor. PGE2 is a growth factor required for the division of cells in the gastrointestinal tract.(b) Kaposi sarcoma, a common tumor in people with untreated AIDS, is caused by a virus carrying a gene for a protein similar to the chemokine receptors CXCR1 and CXCR2. Chemokines are cell-specific growth factors.(c) Adenovirus, a tumor virus, carries a gene for the protein E1A, which binds to the retinoblastoma protein, pRb. (d) An important feature of many oncogenes and tumor suppressor genes is their celltype specificity. For example, mutations in the PGE2 receptor are not typically found in lung tumors. Explain this observation. (Note that PGE2 acts through a GPCR in the plasma membrane.)arrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? Would the outcome of this experiment differ if the experiment had been performed in a yeast line containing mutations in the H3 or H4 histone tails?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY