
GENERAL,ORGANIC,+BIO.CHEM.-MINDTAP
7th Edition
ISBN: 9781305866966
Author: STOKER
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 21.111EP
Interpretation Introduction
Interpretation: The term cell differentiation and the involvement of Vitamin A in this process have to be explained.
Concept introduction: There are four types of fat-soluble vitamins: Vitamin A, Vitamin D, Vitamin E and Vitamin K. Preformed and precursor forms of Vitamin A are obtained from normal dietary intake. Vitamin A performs various important functions in the human body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 21 Solutions
GENERAL,ORGANIC,+BIO.CHEM.-MINDTAP
Ch. 21.1 - Which of the following statements concerning the...Ch. 21.1 - Prob. 2QQCh. 21.2 - Which of the following statements about a...Ch. 21.2 - Which of the following statements about cofactors...Ch. 21.2 - Prob. 3QQCh. 21.3 - Which of the following statements concerning an...Ch. 21.3 - Prob. 2QQCh. 21.3 - Which of the following pairings of enzyme type and...Ch. 21.3 - Which of the following pairings of enzyme type and...Ch. 21.4 - Prob. 1QQ
Ch. 21.4 - Which of the following statements concerning the...Ch. 21.4 - Prob. 3QQCh. 21.5 - The specificity of an enzyme that catalyzes the...Ch. 21.5 - Prob. 2QQCh. 21.6 - The number of substrate molecules converted to...Ch. 21.6 - Prob. 2QQCh. 21.6 - Prob. 3QQCh. 21.7 - Extremozyme presence is not possible in which of...Ch. 21.7 - Prob. 2QQCh. 21.8 - Prob. 1QQCh. 21.8 - Prob. 2QQCh. 21.8 - Prob. 3QQCh. 21.9 - Prob. 1QQCh. 21.9 - Prob. 2QQCh. 21.9 - Prob. 3QQCh. 21.10 - Prob. 1QQCh. 21.10 - Prob. 2QQCh. 21.11 - Prob. 1QQCh. 21.11 - Prob. 2QQCh. 21.12 - Prob. 1QQCh. 21.12 - Prob. 2QQCh. 21.12 - Prob. 3QQCh. 21.13 - Prob. 1QQCh. 21.13 - Prob. 2QQCh. 21.13 - In the recharging of a metal-containing enzyme by...Ch. 21.14 - Prob. 1QQCh. 21.14 - Prob. 2QQCh. 21.14 - Prob. 3QQCh. 21.14 - Which of the B vitamins has a name that draws...Ch. 21.14 - Prob. 5QQCh. 21.14 - Prob. 6QQCh. 21.15 - Prob. 1QQCh. 21.15 - Prob. 2QQCh. 21.15 - Prob. 3QQCh. 21.15 - For which of the following vitamins is blood...Ch. 21.15 - Prob. 5QQCh. 21 - What is the general role of enzymes in the human...Ch. 21 - Why does the body need so many different enzymes?Ch. 21 - Prob. 21.3EPCh. 21 - Prob. 21.4EPCh. 21 - Indicate whether each of the following phrases...Ch. 21 - Indicate whether each of the following phrases...Ch. 21 - Explain why a metal ion can function as a cofactor...Ch. 21 - Prob. 21.8EPCh. 21 - Prob. 21.9EPCh. 21 - Indicate whether each of the following statements...Ch. 21 - Prob. 21.11EPCh. 21 - Based on its name, indicate whether each of the...Ch. 21 - Predict the function of each of the following...Ch. 21 - Predict the function of each of the following...Ch. 21 - Prob. 21.15EPCh. 21 - Prob. 21.16EPCh. 21 - Prob. 21.17EPCh. 21 - Suggest a name for an enzyme that catalyzes each...Ch. 21 - Prob. 21.19EPCh. 21 - Prob. 21.20EPCh. 21 - To which of the six major classes of enzymes does...Ch. 21 - To which of the six major classes of enzymes does...Ch. 21 - Identify the enzyme needed in each of the...Ch. 21 - Identify the enzyme needed in each of the...Ch. 21 - Prob. 21.25EPCh. 21 - Indicate whether each of the following statements...Ch. 21 - Indicate whether each of the statements in Problem...Ch. 21 - Indicate whether each of the statements in Problem...Ch. 21 - Prob. 21.29EPCh. 21 - Prob. 21.30EPCh. 21 - Prob. 21.31EPCh. 21 - Prob. 21.32EPCh. 21 - Indicate whether each of the following statements...Ch. 21 - Indicate whether each of the following statements...Ch. 21 - Prob. 21.35EPCh. 21 - Prob. 21.36EPCh. 21 - Prob. 21.37EPCh. 21 - Prob. 21.38EPCh. 21 - What type of specificity (absolute, group,...Ch. 21 - What type of specificity (absolute, group,...Ch. 21 - The following graph shows the relationship between...Ch. 21 - Based on the graphical information in Problem...Ch. 21 - Prob. 21.43EPCh. 21 - Based on the graphical information in Problem...Ch. 21 - Prob. 21.45EPCh. 21 - Prob. 21.46EPCh. 21 - Draw a graph that shows the effect of increasing...Ch. 21 - Prob. 21.48EPCh. 21 - Prob. 21.49EPCh. 21 - What is an enzyme turnover number?Ch. 21 - Describe the effect that each of the following...Ch. 21 - Describe the effect that each of the following...Ch. 21 - What is an extremophile?Ch. 21 - What are two common environmental settings where...Ch. 21 - Indicate whether each of the following pairings of...Ch. 21 - Indicate whether each of the following pairings of...Ch. 21 - Prob. 21.57EPCh. 21 - What type(s) of extremophiles are used in oil well...Ch. 21 - Prob. 21.59EPCh. 21 - Prob. 21.60EPCh. 21 - Prob. 21.61EPCh. 21 - Indicate whether each of the following statements...Ch. 21 - Prob. 21.63EPCh. 21 - Indicate whether each of the following statements...Ch. 21 - Prob. 21.65EPCh. 21 - Indicate whether each of the following statements...Ch. 21 - Prob. 21.67EPCh. 21 - Prob. 21.68EPCh. 21 - Prob. 21.69EPCh. 21 - Prob. 21.70EPCh. 21 - Prob. 21.71EPCh. 21 - Prob. 21.72EPCh. 21 - Prob. 21.73EPCh. 21 - Prob. 21.74EPCh. 21 - Prob. 21.75EPCh. 21 - Prob. 21.76EPCh. 21 - Prob. 21.77EPCh. 21 - Prob. 21.78EPCh. 21 - Prob. 21.79EPCh. 21 - Prob. 21.80EPCh. 21 - Prob. 21.81EPCh. 21 - Prob. 21.82EPCh. 21 - What is the medical diagnostic value associated...Ch. 21 - Prob. 21.84EPCh. 21 - Indicate whether each of the following is a...Ch. 21 - Indicate whether each of the following is a...Ch. 21 - Prob. 21.87EPCh. 21 - Prob. 21.88EPCh. 21 - Prob. 21.89EPCh. 21 - Prob. 21.90EPCh. 21 - Prob. 21.91EPCh. 21 - What are the structural differences between the...Ch. 21 - Prob. 21.93EPCh. 21 - Prob. 21.94EPCh. 21 - Vitamin C is biosynthesized in a two-step process....Ch. 21 - Prob. 21.96EPCh. 21 - Prob. 21.97EPCh. 21 - Prob. 21.98EPCh. 21 - Prob. 21.99EPCh. 21 - Prob. 21.100EPCh. 21 - Which of the B vitamins has a structure that fits...Ch. 21 - Which of the B vitamins has a structure that fits...Ch. 21 - Prob. 21.103EPCh. 21 - Prob. 21.104EPCh. 21 - Prob. 21.105EPCh. 21 - Prob. 21.106EPCh. 21 - The coenzyme forms of B vitamins are involved in...Ch. 21 - The coenzyme form of B vitamins are involved in...Ch. 21 - Prob. 21.109EPCh. 21 - What is the relationship between the plant pigment...Ch. 21 - Prob. 21.111EPCh. 21 - List four major functions of vitamin A in the...Ch. 21 - Prob. 21.113EPCh. 21 - Prob. 21.114EPCh. 21 - Prob. 21.115EPCh. 21 - Prob. 21.116EPCh. 21 - Prob. 21.117EPCh. 21 - Prob. 21.118EPCh. 21 - Prob. 21.119EPCh. 21 - Prob. 21.120EPCh. 21 - Which structural form of vitamin E exhibits the...Ch. 21 - Prob. 21.122EPCh. 21 - Prob. 21.123EPCh. 21 - Prob. 21.124EPCh. 21 - Prob. 21.125EPCh. 21 - Prob. 21.126EPCh. 21 - Prob. 21.127EPCh. 21 - Prob. 21.128EPCh. 21 - Prob. 21.129EPCh. 21 - Prob. 21.130EPCh. 21 - Prob. 21.131EPCh. 21 - Which vitamin or vitamins has (have) each of the...Ch. 21 - Which of the 13 vitamins has a structure that fits...Ch. 21 - Prob. 21.134EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
DIGESTER-35 | VITAMINS AND THEIR RELATED COENZYMES| GPAT | NIPER | PHARMACIST| DI; Author: GPAT DISCUSSION CENTER;https://www.youtube.com/watch?v=CGrdNYmho0s;License: Standard YouTube License, CC-BY