Human Anatomy & Physiology
1st Edition
ISBN: 9780805382952
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20.4, Problem 1QC
What are MHC molecules?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 20 Solutions
Human Anatomy & Physiology
Ch. 20.1 - What are the main functions of the lymphatic...Ch. 20.1 - 2. How do lymphatic capillaries differ from blood...Ch. 20.1 - What is the pathway of lymph flow from the right...Ch. 20.1 - 4. What main cell types are located in lymphoid...Ch. 20.1 - List the main functions of MALT, lymph nodes, the...Ch. 20.2 - 1. How do innate immunity and adaptive immunity...Ch. 20.2 - 2. What are the three lines of defense?
Ch. 20.2 - What are the bodys main surface barriers, and how...Ch. 20.2 - Prob. 4QCCh. 20.2 - How are the immune system and lymphatic system...
Ch. 20.3 - Match the following cell types with their correct...Ch. 20.3 - Which of the cells in question 1 do not directly...Ch. 20.3 - What is the complement system, and what are its...Ch. 20.3 - In what two ways is the complement system...Ch. 20.3 - 5. What are the main cytokines of innate...Ch. 20.3 - What are the four cardinal signs of inflammation?Ch. 20.3 - 7. What are inflammatory mediators, and what do...Ch. 20.3 - Explain the role of phagocytes in the inflammatory...Ch. 20.3 - What causes the elevated temperature and common...Ch. 20.3 - Prob. 10QCCh. 20.4 - 1. What are MHC molecules?
Ch. 20.4 - 2. How do class I and class II MHC molecules...Ch. 20.4 - How are T cells activated?Ch. 20.4 - Prob. 4QCCh. 20.4 - What are the main functions of TC cells?Ch. 20.4 - Prob. 6QCCh. 20.4 - Prob. 7QCCh. 20.5 - 1. How is a B cell activated?
Ch. 20.5 - Prob. 2QCCh. 20.5 - What are the five classes of antibody, and how do...Ch. 20.5 - 4. List the five main functions of antibodies.
Ch. 20.5 - How do the primary and secondary immune responses...Ch. 20.5 - 6. What is the purpose of a vaccination, and what...Ch. 20.5 - 7. How do active immunity and passive immunity...Ch. 20.6 - How do innate immunity and adaptive immunity work...Ch. 20.6 - Walk through the basic steps of the immune...Ch. 20.6 - How does the immune system survey the body for...Ch. 20.6 - Walk through the steps of the immune response to...Ch. 20.6 - Prob. 5QCCh. 20.6 - 6. How do cancer cells escape the immune response...Ch. 20.7 - Define the four types of hypersensitivity...Ch. 20.7 - Explain how type IV hypersensitivity differs from...Ch. 20.7 - How do primary and secondary immunodeficiency...Ch. 20.7 - Prob. 4QCCh. 20.7 - What is an autoimmune disorder? What produces the...Ch. 20.7 - 6. What are the potential causes of autoimmune...Ch. 20 - 1. Which of the following is not a function of the...Ch. 20 - Mark the following statements as true or false. If...Ch. 20 - Fill in the blanks: The lymphoid organ that...Ch. 20 - Fill in the blanks: Nonspecific immunity is also...Ch. 20 -
5. Which of the following make up the body’s...Ch. 20 - Which of the following does not describe the...Ch. 20 - Mark the following statements as true or false. If...Ch. 20 - Which of the following functions is/are performed...Ch. 20 - Prob. 9CYRCh. 20 - 10. When naïve B cells are activated, they...Ch. 20 - 11. Match the following antibodies with the...Ch. 20 - Mark the following statements as true or false. If...Ch. 20 - Prob. 13CYRCh. 20 - On which type(s) of cells are class I MHC...Ch. 20 - Fill in the blanks: Class I MHC molecules display...Ch. 20 - 16. Which of the following is not a role of TH...Ch. 20 - 17. Mark the following statements as true or...Ch. 20 - 18. Type I hypersensitivity is due to release of...Ch. 20 - Prob. 19CYRCh. 20 - Prob. 20CYRCh. 20 - Prob. 1CYUCh. 20 - Complement proteins are crucial for stimulating...Ch. 20 - 3. Terrence has severe asthma and allergies, and...Ch. 20 - Your friend tests her snake-wrangling skills on an...Ch. 20 - 2. Carla presents to her physician with a...Ch. 20 - 3. Mr. White has been diagnosed with febrile...Ch. 20 - Mr. White developed neutropenia as a consequence...Ch. 20 - 5. The chemotherapeutic drugs Mr. White is taking...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
What is cancer? What causes cancer and how is it treated? *UPDATE*; Author: Cancer Treatment Centers of America - CTCA;https://www.youtube.com/watch?v=_N1Sk3aiSCE;License: Standard Youtube License