
Microbiology: An Introduction
12th Edition
ISBN: 9780321929150
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15, Problem 10R
Summary Introduction
To review:
The OPA1 protein involved in the process of oxidative phosphorylation which takes place in mitochondria.
Introduction:
Neisseria gonorrhea is the gram negative bacteria that infect the female genital tractand it is a causative agent of gonorrhea.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 15 Solutions
Microbiology: An Introduction
Ch. 15 - Compare pathogenicity with virulence.Ch. 15 - How are capsules and cell wall components related...Ch. 15 - Prob. 3RCh. 15 - Explain how drugs that bind each of the following...Ch. 15 - Prob. 5RCh. 15 - Prob. 6RCh. 15 - Prob. 7RCh. 15 - Which of the following genera is the most...Ch. 15 - How can viruses and protozoa avoid being killed by...Ch. 15 - Prob. 10R
Ch. 15 - The removal of plasmids reduces virulence in which...Ch. 15 - Prob. 2MCQCh. 15 - Prob. 3MCQCh. 15 - All of the following can occur during bacterial...Ch. 15 - The ID50 for Campylobacter sp. is 500 cells; the...Ch. 15 - Prob. 6MCQCh. 15 - A drug that binds to mannose on human cells would...Ch. 15 - The earliest smallpox vaccines were infected...Ch. 15 - Prob. 9MCQCh. 15 - Which of the following statements is true? a. The...Ch. 15 - Prob. 1ACh. 15 - Prob. 3ACh. 15 - How do each of the following strategies contribute...Ch. 15 - On July 8, a woman was given an antibiotic for...Ch. 15 - Explain whether each of the following examples is...Ch. 15 - Cancer patients undergoing chemotherapy are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License