Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 14.3, Problem 1TC
For any single person, a given STR always has either one or two bands. Why? Further, single bands are always about twice as bright as each band of a pair. For example, in the D16 STR on the right, the single bands of the first and third DNA samples are twice as bright as the pairs of bands of the second, fourth, and fifth samples. Why?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Based from Fig. 1B, which of the following lanes contain a good quality genomic DNA? Bad quality genomic DNA? Why or Why not? Answer in maximum of 5 sentences only. You can prove your answer by describing the banding pattern of each lanes and how to troubleshoot the DNA extraction procedure if possible.
Listed below are 4 of the 13 genome sites used to create a standard DNA profile. Each site consists of a number of short tandem repeats: sets of 4 nucleotides repeated in a row within the genome. For each site, the number of repeats found at that site for this individual are listed: Imagine you perform a PCR procedure to create a DNA profile for this individual. Which of the following four gels correctly represents the DNA profile of this person?
How would you estimate the size of the unknown DNA fragement just by looking at the gel?
Chapter 14 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 14.1 - define biotechnology?Ch. 14.1 - Prob. 2CYLCh. 14.2 - describe natural processes that recombine DNA,...Ch. 14.3 - Guilty or Innocent? When biological evidence was...Ch. 14.3 - For any single person, a given STR always has...Ch. 14.3 - Prob. 2CSCCh. 14.3 - There are many other applications in which DNA...Ch. 14.3 - Prob. 1CYLCh. 14.3 - Prob. 2CYLCh. 14.3 - Prob. 3CYL
Ch. 14.4 - Restriction enzymes are isolated from bacteria....Ch. 14.4 - explain how genes are inserted into a plasmid, and...Ch. 14.4 - Prob. 2CYLCh. 14.5 - Prob. 1HYEWCh. 14.5 - describe the advantages of genetically modified...Ch. 14.5 - list some examples of how GM animals might be...Ch. 14.5 - Prob. 3CYLCh. 14.6 - Prob. 1CYLCh. 14.6 - explain how knowledge of the genomes of humans and...Ch. 14.7 - Prob. 1TCCh. 14.7 - explain how biotechnology is used to diagnose both...Ch. 14.7 - describe the procedures and advantages of gene...Ch. 14.8 - Genetic engineering is used both in food crops and...Ch. 14.8 - explain why people might be opposed to the use of...Ch. 14.8 - envision circumstances in which it would be...Ch. 14.8 - Prob. 1CSRCh. 14.8 - Prob. 2CTCh. 14 - Prob. 1MCCh. 14 - Prob. 2MCCh. 14 - Prob. 3MCCh. 14 - A restriction enzyme a. cuts DNA at a specific...Ch. 14 - Prob. 5MCCh. 14 - Prob. 1FIBCh. 14 - _________is the process whereby bacteria pick up...Ch. 14 - The _______ is a technique tor multiplying DNA in...Ch. 14 - Matching DNA samples in forensics uses a specific...Ch. 14 - Prob. 5FIBCh. 14 - Prob. 1RQCh. 14 - Prob. 2RQCh. 14 - Prob. 3RQCh. 14 - Prob. 4RQCh. 14 - Prob. 5RQCh. 14 - How does gel electrophoresis separate pieces of...Ch. 14 - Prob. 7RQCh. 14 - Prob. 8RQCh. 14 - Prob. 9RQCh. 14 - Prob. 10RQCh. 14 - As you may know, many Insects have evolved...Ch. 14 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…arrow_forwardChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHarrow_forwardCan you please interpret and discuss and mark, this gel electrophoresis results. DNA ladder sizes: Band1: 23130, Band2: 9416, Band3: 6557, Band4: 4361, Band5: 2322, Band6: 564, Band7: 125arrow_forward
- In our simple model of DNA amplification we assumed that a successful amplification doubled the DNA each cycle. Reality isn't so kind! Two related problems encountered in DNA profiling are the issues of asymmetric peaks and "drop-out" where an allele produces a small to very-small peak compared to the other allele. Assume you have a sample with a heterozygous set of alleles. Let one of the alleles be successfully doubled each cycle but the second allele is (on average) only increased by 1.8. If the sample is subjected to 30 PCR cycles, how much larger will the "successful" peak be than the "less successful" peak? Set your answer up as a ratio of the "successful" /"unsuccessful" and round your number to 1 decimal place. (for example, if your calculations show that after 30 cycles the successful allele has 55340 copies and the unsuccessful has 10000 copies the ratio is 5.5)arrow_forwardIn DNA isolation techniques, a washing step is always done prior to the final resuspension. What is the purpose of this step? In DNA isolation from blood samples, why does the vial for blood storage contain EDTA? In the preparation for DNA isolation in plants, the plant source is refrigerated and ground prior to extraction. Why is this so? Why are DNA pellets air-dried before resuspension in buffer?arrow_forwardBased on the electrophoresis experiment, 0.7% agarose gel concentration was used. If the gel concentration increased to 1%, what would happen to the DNA migration? Explain briefly.arrow_forward
- You have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.arrow_forwardWhy was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have to do this step with an animal cells). Why do we treat the cells with soap when conducting DNA extraction? And why do we add salt when doing the DNA extraction?arrow_forwardWhich one is the correct one?arrow_forward
- Why is sodium acetate used in DNA precipitation by ethanol, rather than sodium chloride? (Hint – acetate is an organic ion. Chloride is not.)arrow_forwardA blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?arrow_forwardA batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by HindIII alone, and finally, a third batch is fully digested by both HpaI and HindIII together. The fragments resulting from each of the three digestions are placed in separate wells of an agarose gel, separated by gel electrophoresis, and stained by ethidium bromide. Draw the bands as they would appear on the gel.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license