The process of developing DNA profiles. Introduction: Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy. The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Question

Want to see the full answer?

Answer 1

Question

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Answer 6

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Answer 7

Chapter 14.3, Problem 2CYL

Summary Introduction

To describe:

The process of developing DNA profiles.

Introduction:

Polymerase chain reaction is used to amplify the DNA so that there is enough to compare the DNA left at a crime scene with a suspect’s. Short tandem repeats (STRs) are the specific segments of DNA that can be used to identify people with astonishing accuracy.

The location of STRs that are run on gels produces a pattern called a DNA profile. Unrelated people almost never have identical DNA profiles.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 14.1 - define biotechnology?Ch. 14.1 - Prob. 2CYL Ch. 14.2 - describe natural processes that recombine DNA,...Ch. 14.3 - Guilty or Innocent? When biological evidence was...Ch. 14.3 - For any single person, a given STR always has...Ch. 14.3 - Prob. 2CSC Ch. 14.3 - There are many other applications in which DNA...Ch. 14.3 - Prob. 1CYL Ch. 14.3 - Prob. 2CYL Ch. 14.3 - Prob. 3CYL

Solution Summary: The author describes the process of developing a DNA profile by using polymerase chain reaction and short tandem repeats.

Concept explainers

Want to see the full answer?

Chapter 14 Solutions