
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
7th Edition
ISBN: 8220100853180
Author: STOKER
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14.20, Problem 3QQ
Interpretation Introduction
Interpretation:
IUPAC name for the given compound has to be chosen from the given options.
Concept Introduction:
IUPAC rules for naming thioalcohols that contain single thiol group:
- • Longest carbon chain has to be identified that contains thiol group also. The chain name is obtained by adding the suffix “-thiol”. If the compound contains an unsaturated bond, then the respective name has to be changed with regard to
alkane . - • The numbering has to be given so that the thiol group gets the least numbering.
- • Name and location of any other substituent present in the chain has to be identified.
- • If in a ring the thiol group is present, then that carbon is numbered 1 and the numbering then proceeds counterclockwise or clockwise in a way that substituents present if any gets the least numbering.
IUPAC rules for naming thioalcohols that contain more than one thiol group:
- • The same rules said above is followed but the prefix di-, tri-, tetra etc is added corresponding to the number of thiol groups that is present.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 14 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
Ch. 14.1 - Prob. 1QQCh. 14.1 - Prob. 2QQCh. 14.2 - Prob. 1QQCh. 14.2 - Prob. 2QQCh. 14.2 - Prob. 3QQCh. 14.3 - Prob. 1QQCh. 14.3 - Prob. 2QQCh. 14.3 - Prob. 3QQCh. 14.3 - Prob. 4QQCh. 14.4 - Prob. 1QQ
Ch. 14.4 - Prob. 2QQCh. 14.4 - Prob. 3QQCh. 14.5 - Prob. 1QQCh. 14.5 - Prob. 2QQCh. 14.5 - Prob. 3QQCh. 14.5 - Prob. 4QQCh. 14.6 - Prob. 1QQCh. 14.6 - Prob. 2QQCh. 14.6 - Prob. 3QQCh. 14.7 - Prob. 1QQCh. 14.7 - Prob. 2QQCh. 14.8 - Prob. 1QQCh. 14.8 - Prob. 2QQCh. 14.9 - Prob. 1QQCh. 14.9 - Prob. 2QQCh. 14.9 - Prob. 3QQCh. 14.9 - Prob. 4QQCh. 14.9 - Prob. 5QQCh. 14.9 - Prob. 6QQCh. 14.10 - Prob. 1QQCh. 14.10 - Prob. 2QQCh. 14.11 - Prob. 1QQCh. 14.11 - Prob. 2QQCh. 14.11 - Prob. 3QQCh. 14.12 - Prob. 1QQCh. 14.12 - Prob. 2QQCh. 14.13 - Prob. 1QQCh. 14.13 - Prob. 2QQCh. 14.13 - Prob. 3QQCh. 14.14 - Prob. 1QQCh. 14.14 - Prob. 2QQCh. 14.14 - Prob. 3QQCh. 14.15 - Prob. 1QQCh. 14.15 - Prob. 2QQCh. 14.15 - Prob. 3QQCh. 14.15 - Prob. 4QQCh. 14.16 - Prob. 1QQCh. 14.16 - Prob. 2QQCh. 14.17 - Prob. 1QQCh. 14.17 - Prob. 2QQCh. 14.17 - Prob. 3QQCh. 14.18 - Prob. 1QQCh. 14.18 - Prob. 2QQCh. 14.18 - Prob. 3QQCh. 14.19 - Prob. 1QQCh. 14.19 - Prob. 2QQCh. 14.20 - Prob. 1QQCh. 14.20 - Prob. 2QQCh. 14.20 - Prob. 3QQCh. 14.20 - Prob. 4QQCh. 14.20 - Prob. 5QQCh. 14.21 - Prob. 1QQCh. 14.21 - Prob. 2QQCh. 14.21 - Prob. 3QQCh. 14.21 - Prob. 4QQCh. 14.21 - Prob. 5QQCh. 14 - Prob. 14.1EPCh. 14 - Prob. 14.2EPCh. 14 - Prob. 14.3EPCh. 14 - Prob. 14.4EPCh. 14 - Prob. 14.5EPCh. 14 - Prob. 14.6EPCh. 14 - Prob. 14.7EPCh. 14 - Prob. 14.8EPCh. 14 - Prob. 14.9EPCh. 14 - Prob. 14.10EPCh. 14 - Write a condensed structural formula for each of...Ch. 14 - Write a condensed structural formula for each of...Ch. 14 - Prob. 14.13EPCh. 14 - Prob. 14.14EPCh. 14 - Prob. 14.15EPCh. 14 - Prob. 14.16EPCh. 14 - Prob. 14.17EPCh. 14 - Prob. 14.18EPCh. 14 - Each of the following alcohols is named...Ch. 14 - Prob. 14.20EPCh. 14 - Prob. 14.21EPCh. 14 - Prob. 14.22EPCh. 14 - Prob. 14.23EPCh. 14 - Prob. 14.24EPCh. 14 - Prob. 14.25EPCh. 14 - Prob. 14.26EPCh. 14 - Prob. 14.27EPCh. 14 - Prob. 14.28EPCh. 14 - Prob. 14.29EPCh. 14 - Prob. 14.30EPCh. 14 - Prob. 14.31EPCh. 14 - Prob. 14.32EPCh. 14 - Prob. 14.33EPCh. 14 - Prob. 14.34EPCh. 14 - Explain why the boiling points of alcohols are...Ch. 14 - Explain why the water solubilities of alcohols are...Ch. 14 - Prob. 14.37EPCh. 14 - Prob. 14.38EPCh. 14 - Prob. 14.39EPCh. 14 - Which member of each of the following pairs of...Ch. 14 - Determine the maximum number of hydrogen bonds...Ch. 14 - Determine the maximum number of hydrogen bonds...Ch. 14 - Prob. 14.43EPCh. 14 - Prob. 14.44EPCh. 14 - Prob. 14.45EPCh. 14 - Prob. 14.46EPCh. 14 - Classify each of the following alcohols as a...Ch. 14 - Classify each of the following alcohols as a...Ch. 14 - Classify each of the following alcohols as a...Ch. 14 - Classify each of the following alcohols as a...Ch. 14 - Prob. 14.51EPCh. 14 - Prob. 14.52EPCh. 14 - Prob. 14.53EPCh. 14 - Prob. 14.54EPCh. 14 - Prob. 14.55EPCh. 14 - Prob. 14.56EPCh. 14 - Prob. 14.57EPCh. 14 - Prob. 14.58EPCh. 14 - Prob. 14.59EPCh. 14 - Prob. 14.60EPCh. 14 - The alcohol 2,2-dimethyl-1-butanol cannot be...Ch. 14 - Prob. 14.62EPCh. 14 - Prob. 14.63EPCh. 14 - Prob. 14.64EPCh. 14 - Draw the structure of the aldehyde or ketone...Ch. 14 - Draw the structure of the aldehyde or ketone...Ch. 14 - Prob. 14.67EPCh. 14 - Prob. 14.68EPCh. 14 - Prob. 14.69EPCh. 14 - Prob. 14.70EPCh. 14 - Three isomeric pentanols with unbranched carbon...Ch. 14 - Prob. 14.72EPCh. 14 - Prob. 14.73EPCh. 14 - Prob. 14.74EPCh. 14 - Prob. 14.75EPCh. 14 - Prob. 14.76EPCh. 14 - Prob. 14.77EPCh. 14 - Prob. 14.78EPCh. 14 - Prob. 14.79EPCh. 14 - Prob. 14.80EPCh. 14 - Prob. 14.81EPCh. 14 - Prob. 14.82EPCh. 14 - Prob. 14.83EPCh. 14 - Prob. 14.84EPCh. 14 - Prob. 14.85EPCh. 14 - Prob. 14.86EPCh. 14 - Prob. 14.87EPCh. 14 - Prob. 14.88EPCh. 14 - Prob. 14.89EPCh. 14 - Prob. 14.90EPCh. 14 - Prob. 14.91EPCh. 14 - Classify each of the following compounds as an...Ch. 14 - Draw or write the following for the simplest ether...Ch. 14 - Draw or write the following for the simplest ether...Ch. 14 - Prob. 14.95EPCh. 14 - Prob. 14.96EPCh. 14 - Prob. 14.97EPCh. 14 - Prob. 14.98EPCh. 14 - Prob. 14.99EPCh. 14 - Prob. 14.100EPCh. 14 - Prob. 14.101EPCh. 14 - Prob. 14.102EPCh. 14 - Prob. 14.103EPCh. 14 - Prob. 14.104EPCh. 14 - Prob. 14.105EPCh. 14 - Prob. 14.106EPCh. 14 - Prob. 14.107EPCh. 14 - Prob. 14.108EPCh. 14 - Prob. 14.109EPCh. 14 - Prob. 14.110EPCh. 14 - Prob. 14.111EPCh. 14 - Prob. 14.112EPCh. 14 - Prob. 14.113EPCh. 14 - Give common names for all ethers that are...Ch. 14 - How many isomeric ethers exist when the R groups...Ch. 14 - Prob. 14.116EPCh. 14 - Prob. 14.117EPCh. 14 - Draw condensed structural formulas for the...Ch. 14 - Prob. 14.119EPCh. 14 - Prob. 14.120EPCh. 14 - Prob. 14.121EPCh. 14 - Prob. 14.122EPCh. 14 - Prob. 14.123EPCh. 14 - How do the chemical reactivities of ethers compare...Ch. 14 - Explain why ether molecules cannot hydrogen-bond...Ch. 14 - How many hydrogen bonds can form between a single...Ch. 14 - Classify each of the following molecular...Ch. 14 - Classify each of the following molecular...Ch. 14 - Prob. 14.129EPCh. 14 - Prob. 14.130EPCh. 14 - Prob. 14.131EPCh. 14 - Draw a condensed structural formula for each of...Ch. 14 - Prob. 14.133EPCh. 14 - Prob. 14.134EPCh. 14 - Prob. 14.135EPCh. 14 - Prob. 14.136EPCh. 14 - Prob. 14.137EPCh. 14 - For each of the following pairs of compounds,...Ch. 14 - Assign an IUPAC name to each of the following...Ch. 14 - Prob. 14.140EPCh. 14 - Prob. 14.141EPCh. 14 - Prob. 14.142EPCh. 14 - Prob. 14.143EPCh. 14 - Prob. 14.144EPCh. 14 - Prob. 14.145EPCh. 14 - Prob. 14.146EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning