Genetic Analysis: An Integrated Approach (3rd Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
bartleby

Videos

Textbook Question
Book Icon
Chapter 14, Problem 17P

How would you perform a genetic screen to identify genes directing Drosophila wing development? Once you have a collection of wing - development mutants, how would you analyse your mutagenesis to learn how many genes are represented and how many alleles of each gene? How would you discover whether the genes act in the same or different pathways, and if in the same pathway, how do you discover the order in which they act? How would you clone the genes?

Blurred answer
Students have asked these similar questions
A wild type strain of Drosophila was found to carry a transposable element called copia.From this strain (red eyed), a white-eyed strain was obtained in which the copia element hadtransposed to a region on the X-chromosome that corresponded to where the eye-color genemapped. How would you clone the eye-color gene and confirm your discovery?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.   You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?               You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?     5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’         After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
How would you devise a screen to identify recessive mutations in Drosophila that result in embryo lethality? How would you propagate the recessive mutant alleles?

Chapter 14 Solutions

Genetic Analysis: An Integrated Approach (3rd Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY