Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 14, Problem 17P
How would you perform a genetic screen to identify genes directing Drosophila wing development? Once you have a collection of wing
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A wild type strain of Drosophila was found to carry a transposable element called copia.From this strain (red eyed), a white-eyed strain was obtained in which the copia element hadtransposed to a region on the X-chromosome that corresponded to where the eye-color genemapped. How would you clone the eye-color gene and confirm your discovery?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
How would you devise a screen to identify recessive mutations in Drosophila that result in embryo lethality? How would you propagate the recessive mutant alleles?
Chapter 14 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 14 - 14.1 What are the advantages and disadvantages of...Ch. 14 - Prob. 2PCh. 14 - Discuss the similarities and differences between...Ch. 14 - 14.5 What are the advantages and disadvantages of...Ch. 14 - 14.6 You have cloned the mouse ortholog (see...Ch. 14 - 14.7 Diagram the mechanism by which CRISPRCas...Ch. 14 - 14.8 Describe how CRISPRCas has been modified to...Ch. 14 - 14.9 Discuss the advantages (and possible...Ch. 14 - 14.10 Discuss the advantages (and possible...Ch. 14 - You have identifies a gene encoding the protein...
Ch. 14 - You have identified a recessive mutation that...Ch. 14 - 14.13 The CBF genes of Arabidopsis are induced by...Ch. 14 - 14.14 When the S. cerevisiae genome was sequenced,...Ch. 14 - 14.15 Translational fusions between a protein of...Ch. 14 - 14.16 In humans, Duchenne’s muscular dystrophy is...Ch. 14 - 14.17 How would you perform a genetic screen to...Ch. 14 - In enhancer trapping experiments, a minimal...Ch. 14 - 14.19 In Genetic Analysis, we designed a screen to...Ch. 14 - How would you design a genetic screen to find...Ch. 14 - 14.21 The eyes of Drosophila develop from imaginal...Ch. 14 - 14.22 Given your knowledge of the genetic tools...Ch. 14 - Mutations in the CFTR gene result in cystic...Ch. 14 - 14.24 How would you clone a gene that you have...Ch. 14 - 14.25 How would you conduct a screen to identify...Ch. 14 - In land plants, there is an alternation of...Ch. 14 - 14.27 The Drosophila evenskipped (eve) gene is...Ch. 14 - Prob. 28PCh. 14 - 14.29 As shown in Figure, mutations in the...Ch. 14 - How would you edit a specific nucleotide in a...Ch. 14 - Through a forward genetics screen in Arabidopsis...Ch. 14 - The CRISPR - Cas 9 complex directs the Cas 9...Ch. 14 - 14.33 Describe how enhancer screens can be used to...Ch. 14 - How might you use CRISPR - Cas 9 to create a large...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Suppose that you have just graduated from college and have started working at a biotechnology firm. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; however, the mouse gene for prolactin has been cloned, and the amino acid sequence of mouse prolactin is known. Briefly explain two different strategies that you might use to find and clone the pig gene for prolactin.arrow_forwardNext-generation sequencing reveals that six new mutations have occurred in the coding regions of genes in an individual diploid fly. If the coding regions of this fly comprise 100 million nucleotides per haploid genome, what is the mutation rate per nucleotide?arrow_forwardAs an alternative to random mutagenesis, scientistscan screen for mutant phenotypes by knocking downindividual gene functions systematically using RNAi.a. Suggest ways to construct transgenes that in flieswould express RNAi to knock down a gene.b. How could you perform a mutant screen for fly genesrequired for wing development using RNAi? Howcould this screen avoid the problem of pleiotropy?arrow_forward
- Expression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? please try to explain a bit elaborately.arrow_forwardIn yeast, you have sequenced a piece of wild-type DNA and it clearly contains a gene, but you do not know what gene it is. Therefore, to investigate further, you would like to find out its mutant phenotype. How would you use the cloned wild-type gene to do so? Show your experimental steps clearlyarrow_forwardYou just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteomearrow_forward
- Discuss how ultra violet light works as a mutagen. This could include: What is UV light and the Mutations commonly introduced by UV light? What are the Repair mechanisms in yeast that fix damage caused by UV light? Describe the phenotypes of Saccharomyces Cerevisiae plates, the first plate is the control yeast, while the second plate has been exposed to low UV light, the third plate has been exposed to high UV light. Normal yeast has round smooth white colonies. Are there any signinifcant differences?arrow_forwardexpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use.in an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. will this strategy result in good expression of gene X? why or why not?arrow_forwardDraw a basket mutant embryo. What does basket encode? Why do the mutant embryos have this phenotype?arrow_forward
- Although several different mammalian species have been cloned, the efficiency of this process is extremely low. Often tens or even hundreds of oocytes must be implanted with donor nuclei to obtain one healthy live birth. Many researchers believe the difficulties with cloning reside in the epigenetic modifications, such as DNA and histone methylation, that occur within various cells during an individual’s life. How do you suspect such modifications might affect the success of an experimentarrow_forwardAnother way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryoarrow_forwardFor the first experiment ever on Drosophila mutations. Answer the following questions. a. What is the title of the first published paper explained the experiment and what is the name of the Author? b. What is the first mutation discovered in Drosophila? c. Explain the changes in the Drosophila yellow mutant (Y)compared to wild type.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY