Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 14, Problem 22P
Given your knowledge of the genetic tools for studying Drosophila, outline a method by which you could clone the dunce and rutabaga genes identified by Seymour Benzer’s laboratory in the genetic screen described at the beginning of this chapter.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please help me with the question below - it is linked to developmental biology/genomics. Please be as brief and concise as possible, while being sure to completely answer the question.
Transcriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment.
(1) DNA sequencing
(2) Allow for hybridization and wash excess cRNA.
(3) Mix labeled cRNA with array chip.
(4) PCR amplification
(5) Measure fluorescence intensity to determine abundance of transcripts.
(6) Add labeled cRNA at each microarray location.
(7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts.
(8) mRNA isolation from cells
(9) Prepare fluorescently labeled cRNA probes
(10) cDNA synthesis
From the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section).
QUESTION
What is the “Official Symbol” and “Official Full Name” for this gene?
Chapter 14 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 14 - 14.1 What are the advantages and disadvantages of...Ch. 14 - Prob. 2PCh. 14 - Discuss the similarities and differences between...Ch. 14 - 14.5 What are the advantages and disadvantages of...Ch. 14 - 14.6 You have cloned the mouse ortholog (see...Ch. 14 - 14.7 Diagram the mechanism by which CRISPRCas...Ch. 14 - 14.8 Describe how CRISPRCas has been modified to...Ch. 14 - 14.9 Discuss the advantages (and possible...Ch. 14 - 14.10 Discuss the advantages (and possible...Ch. 14 - You have identifies a gene encoding the protein...
Ch. 14 - You have identified a recessive mutation that...Ch. 14 - 14.13 The CBF genes of Arabidopsis are induced by...Ch. 14 - 14.14 When the S. cerevisiae genome was sequenced,...Ch. 14 - 14.15 Translational fusions between a protein of...Ch. 14 - 14.16 In humans, Duchenne’s muscular dystrophy is...Ch. 14 - 14.17 How would you perform a genetic screen to...Ch. 14 - In enhancer trapping experiments, a minimal...Ch. 14 - 14.19 In Genetic Analysis, we designed a screen to...Ch. 14 - How would you design a genetic screen to find...Ch. 14 - 14.21 The eyes of Drosophila develop from imaginal...Ch. 14 - 14.22 Given your knowledge of the genetic tools...Ch. 14 - Mutations in the CFTR gene result in cystic...Ch. 14 - 14.24 How would you clone a gene that you have...Ch. 14 - 14.25 How would you conduct a screen to identify...Ch. 14 - In land plants, there is an alternation of...Ch. 14 - 14.27 The Drosophila evenskipped (eve) gene is...Ch. 14 - Prob. 28PCh. 14 - 14.29 As shown in Figure, mutations in the...Ch. 14 - How would you edit a specific nucleotide in a...Ch. 14 - Through a forward genetics screen in Arabidopsis...Ch. 14 - The CRISPR - Cas 9 complex directs the Cas 9...Ch. 14 - 14.33 Describe how enhancer screens can be used to...Ch. 14 - How might you use CRISPR - Cas 9 to create a large...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…arrow_forwardPlease answerarrow_forwardFor the first experiment ever on Drosophila mutations. Answer the following questions. a. What is the title of the first published paper explained the experiment and what is the name of the Author? b. What is the first mutation discovered in Drosophila? c. Explain the changes in the Drosophila yellow mutant (Y)compared to wild type.arrow_forward
- Can you suggest how we could have determined whether Bill’s aunts were carriers of the mutant BTK gene? Give the name for the procedure and brief explanation of how it’s done and the anticipated results. What controls would be needed?arrow_forwardYou are asked to design PCR primers (18 nucleotides) to amplify the coding region (without the stop codon) of the following gene. Please write down the sequences of primers. (Indicate the 5' and 3' of the primers). 4. 5'atgaagaccaatagagagcaggaaatttacgttgaaagaagcttcaaaccaaacaattcaacaattcagaatttgatggacattgaaag gttcattttgcctcacacttctacatcaggtgtcgcaaggctcaaaatgagggtcatatcatgggtegggcttcagttctacaactactga-3’arrow_forwardYou are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1? ( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.arrow_forward
- Not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.arrow_forwardWatch the following video called "Human Genome Project Video" (https://fod.infobase.com/OnDemandEmbed.aspx?lti=1&token=30037&wID=97629&loid=0&w=400&h=300) then answer the following question in one paragraph each with evidence from the film to support your answers. 1) In one paragraph, explain in detail the purpose of decoding the entire human genome according to what you have seen from the provided link video, read online or read from the book. 2) In one paragraph, explain how has decoding the human genome been used in medicine? Give a couple of examples from the provided video link and provide a detailed explanation.arrow_forwardYou just graduated from college and started working at a biotech startup called Scrofabulous. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; What would be the most useful and economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to design a pair of degenerate oligonucleotide PCR primers to PCR-amplify the pig prolactin gene. RNAseq the pituitary gland of the pig, the most abundant gene is likely to to be prolactin Conduct a proteome search for peptides that match parts of mouse prolactin protein Sequence the pig genome, then translate the genome to find the gene predicted to encode for prolactin Crystalize the mouse prolactin protein and use Google's DeepMind Al to find the closest amino acid sequence in the pig proteomearrow_forward
- Mutations in the HPRT1 gene in humans result in atleast two clinical syndromes. Consult OMIM (www.omim.org) by querying HPRT1; you will only needto look briefly at the top three hits (files #300322,300323, and 308000).a. What is the full name of the HPRT1 enzyme?b. On which chromosome is the HPRT1 gene located?c. Mutations in HPRT1 are associated with two different syndromes. What are these syndromes? Foreach, answer the following questions: (i) What arethe symptoms associated with the syndrome? (ii) Isthe mutant allele that causes the syndrome dominant, recessive, codominant, or incompletely dominant with respect to the normal allele, or do specialconditions apply? (iii) Is the syndrome associatedwith a loss-of-function or a gain-of-function disease allele? (iv) Does the syndrome display allelicheterogeneity? (v) Does the syndrome display locus heterogeneity? (Note: You do not need to understand everything in the OMIM entries to answerthese questions.)arrow_forwardAnswer each of the following questions correctly.(2-5 sentences only)(DO NOT USE THE EXAMPLE I PROVIDED FOR YOUR ANSWER( A. How cloning and expression of certain genes allows for massive production of the desired product.(Give an specific example, AGAIN PLEASE DO NOT USE THIS EXAMPLE AS YOUR EXAMPLE FOR MY QUESTION. YOU ARE NOT ALLOWED TO COPY AND PASTE MY EXAMPLE FOR YOUR ANSWER. PLEASE PROVIDE ANOTHER EXAMPLE .DO NOT USE MY EXAMPLE) For example: the cloning and expression of insulin in bacteria allows for the mass production of this necessary protein for use by diabetic patients.arrow_forwardBioinformatics is an interdisciplinary field that integrates knowledge of computer science with mathematics and statistics to solve biological questions. Many bioinformatics tools for gene prediction, homology modelling and such are available free online. (1) What does BLAST stand for? (ii) Explain the function of BLAST.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY